Incidental Mutation 'R7626:Smarcad1'
ID589443
Institutional Source Beutler Lab
Gene Symbol Smarcad1
Ensembl Gene ENSMUSG00000029920
Gene NameSWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1
SynonymsD6Pas1, Etl1
MMRRC Submission
Accession Numbers

Genbank: NM_007958; MGI: 95453

Is this an essential gene? Possibly non essential (E-score: 0.418) question?
Stock #R7626 (G1)
Quality Score186.009
Status Validated
Chromosome6
Chromosomal Location65042583-65116061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 65096049 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 604 (S604R)
Ref Sequence ENSEMBL: ENSMUSP00000031984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031984] [ENSMUST00000204620]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031984
AA Change: S604R

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031984
Gene: ENSMUSG00000029920
AA Change: S604R

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
low complexity region 143 156 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 488 682 2.58e-38 SMART
Blast:DEXDc 685 745 4e-16 BLAST
HELICc 879 962 4.58e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203411
Predicted Effect probably benign
Transcript: ENSMUST00000204620
SMART Domains Protein: ENSMUSP00000144767
Gene: ENSMUSG00000029920

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SNF subfamily of helicase proteins. The encoded protein plays a critical role in the restoration of heterochromatin organization and propagation of epigenetic patterns following DNA replication by mediating histone H3/H4 deacetylation. Mutations in this gene are associated with adermatoglyphia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded growth, impaired fertility, skeletal dysplasias, and peri- and postnatal lethality. Mutant phenotypes are influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(258) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(256)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tll1 T C 8: 64,098,234 probably null Het
Tmem135 A T 7: 89,156,510 probably null Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Smarcad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Smarcad1 APN 6 65073239 missense probably damaging 1.00
IGL02707:Smarcad1 APN 6 65052806 unclassified probably benign
IGL03006:Smarcad1 APN 6 65083889 missense probably benign 0.01
IGL03131:Smarcad1 APN 6 65074953 missense probably damaging 0.96
IGL03406:Smarcad1 APN 6 65092526 missense probably damaging 0.98
Trollip UTSW 6 65114336 missense probably damaging 1.00
wastrel UTSW 6 65052670 missense probably damaging 1.00
N/A - 293:Smarcad1 UTSW 6 65074914 missense probably benign 0.06
R0020:Smarcad1 UTSW 6 65084007 splice site probably benign
R0452:Smarcad1 UTSW 6 65074822 missense possibly damaging 0.66
R1005:Smarcad1 UTSW 6 65108727 missense probably benign 0.30
R1143:Smarcad1 UTSW 6 65096694 missense probably benign 0.02
R1624:Smarcad1 UTSW 6 65052647 missense probably benign 0.40
R1629:Smarcad1 UTSW 6 65067107 missense probably benign 0.00
R1705:Smarcad1 UTSW 6 65056416 missense probably damaging 1.00
R2000:Smarcad1 UTSW 6 65073216 missense probably damaging 1.00
R2979:Smarcad1 UTSW 6 65075011 missense probably benign 0.00
R3937:Smarcad1 UTSW 6 65114336 missense probably damaging 1.00
R4391:Smarcad1 UTSW 6 65056459 missense probably benign 0.17
R4648:Smarcad1 UTSW 6 65067089 missense probably benign 0.04
R4697:Smarcad1 UTSW 6 65052641 missense probably benign 0.00
R4709:Smarcad1 UTSW 6 65075115 missense probably benign 0.01
R4726:Smarcad1 UTSW 6 65075041 missense probably damaging 1.00
R4776:Smarcad1 UTSW 6 65098824 missense probably null 1.00
R4928:Smarcad1 UTSW 6 65074914 missense probably benign 0.06
R5619:Smarcad1 UTSW 6 65111881 missense probably benign 0.03
R5709:Smarcad1 UTSW 6 65074762 missense probably benign 0.01
R6038:Smarcad1 UTSW 6 65073248 missense possibly damaging 0.91
R6038:Smarcad1 UTSW 6 65073248 missense possibly damaging 0.91
R6220:Smarcad1 UTSW 6 65114329 missense probably benign 0.09
R6302:Smarcad1 UTSW 6 65075138 missense possibly damaging 0.93
R7014:Smarcad1 UTSW 6 65052670 missense probably damaging 1.00
R7149:Smarcad1 UTSW 6 65052732 missense probably benign 0.11
R7378:Smarcad1 UTSW 6 65110376 missense probably benign 0.16
R7569:Smarcad1 UTSW 6 65052711 missense probably benign 0.11
R7774:Smarcad1 UTSW 6 65107830 missense probably damaging 1.00
R8079:Smarcad1 UTSW 6 65052782 missense possibly damaging 0.51
R8119:Smarcad1 UTSW 6 65094319 missense probably benign
R8129:Smarcad1 UTSW 6 65067094 missense probably benign 0.09
R8558:Smarcad1 UTSW 6 65083924 missense probably benign 0.09
R8679:Smarcad1 UTSW 6 65111881 missense probably benign 0.03
R8770:Smarcad1 UTSW 6 65052734 missense probably benign
R8795:Smarcad1 UTSW 6 65072049 missense not run
Predicted Primers PCR Primer
(F):5'- GGTGTCACACATGTACTTACATAGC -3'
(R):5'- AGTATGACAGTGGCCACAGG -3'

Sequencing Primer
(F):5'- AAAGACCACATTGTGTCC -3'
(R):5'- AAAGAACTTTAAAGGAAAAGCTTGC -3'
Posted On2019-10-24