Incidental Mutation 'R7626:Plekhg6'
ID589445
Institutional Source Beutler Lab
Gene Symbol Plekhg6
Ensembl Gene ENSMUSG00000038167
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 6
SynonymsLOC213522
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7626 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location125362660-125380793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125363668 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 576 (D576E)
Ref Sequence ENSEMBL: ENSMUSP00000037004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032491] [ENSMUST00000042647] [ENSMUST00000144524]
Predicted Effect probably benign
Transcript: ENSMUST00000032491
SMART Domains Protein: ENSMUSP00000032491
Gene: ENSMUSG00000030341

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 44 81 2.4e-7 SMART
TNFR 84 125 2.19e-10 SMART
TNFR 127 166 5.43e-6 SMART
TNFR 168 195 3.41e1 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 263 276 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
DEATH 345 441 8.04e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042647
AA Change: D576E

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000037004
Gene: ENSMUSG00000038167
AA Change: D576E

DomainStartEndE-ValueType
RhoGEF 165 352 1.5e-44 SMART
PH 410 511 8.99e-7 SMART
low complexity region 535 557 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125880
SMART Domains Protein: ENSMUSP00000121968
Gene: ENSMUSG00000030341

DomainStartEndE-ValueType
TNFR 2 42 2.09e-7 SMART
TNFR 44 83 5.43e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144524
SMART Domains Protein: ENSMUSP00000117470
Gene: ENSMUSG00000030341

DomainStartEndE-ValueType
TNFR 5 44 5.43e-6 SMART
TNFR 46 73 3.41e1 SMART
transmembrane domain 90 112 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 168 179 N/A INTRINSIC
Blast:DEATH 223 295 1e-13 BLAST
SCOP:d1icha_ 269 295 3e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tll1 T C 8: 64,098,234 probably null Het
Tmem135 A T 7: 89,156,510 probably null Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Plekhg6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Plekhg6 APN 6 125372551 missense probably null 0.89
IGL01466:Plekhg6 APN 6 125372624 splice site probably benign
IGL01621:Plekhg6 APN 6 125372099 missense probably damaging 1.00
IGL01679:Plekhg6 APN 6 125374979 missense probably benign 0.45
IGL01696:Plekhg6 APN 6 125378830 missense probably benign 0.00
IGL02600:Plekhg6 APN 6 125370600 nonsense probably null
IGL02604:Plekhg6 APN 6 125377379 splice site probably benign
IGL02668:Plekhg6 APN 6 125372803 splice site probably benign
R0370:Plekhg6 UTSW 6 125370660 missense probably damaging 1.00
R0426:Plekhg6 UTSW 6 125364629 unclassified probably null
R1182:Plekhg6 UTSW 6 125372492 missense probably damaging 0.99
R1401:Plekhg6 UTSW 6 125363109 missense probably damaging 1.00
R1855:Plekhg6 UTSW 6 125375839 missense probably damaging 1.00
R1888:Plekhg6 UTSW 6 125363343 missense probably damaging 1.00
R1888:Plekhg6 UTSW 6 125363343 missense probably damaging 1.00
R2264:Plekhg6 UTSW 6 125377468 missense probably benign 0.00
R2991:Plekhg6 UTSW 6 125370469 missense probably damaging 0.99
R3980:Plekhg6 UTSW 6 125373183 missense probably damaging 1.00
R4193:Plekhg6 UTSW 6 125373118 missense probably benign 0.01
R4227:Plekhg6 UTSW 6 125378805 missense probably damaging 0.99
R4689:Plekhg6 UTSW 6 125373181 missense probably benign 0.43
R5532:Plekhg6 UTSW 6 125372551 missense possibly damaging 0.80
R5573:Plekhg6 UTSW 6 125375792 missense possibly damaging 0.56
R6803:Plekhg6 UTSW 6 125363663 missense probably damaging 0.98
R6885:Plekhg6 UTSW 6 125378730 missense probably benign
R7105:Plekhg6 UTSW 6 125378805 missense probably damaging 0.99
R7599:Plekhg6 UTSW 6 125374660 missense probably damaging 0.99
R8069:Plekhg6 UTSW 6 125363046 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TAGGATCCCTTCTGGCAACTCTG -3'
(R):5'- ACTGTCCTGCACTGAGACAG -3'

Sequencing Primer
(F):5'- TTCTGGCAACTCTGGGGCG -3'
(R):5'- CACTGAGACAGGGCAGTAAGTTTG -3'
Posted On2019-10-24