Incidental Mutation 'R7626:Ppp1r37'
ID589446
Institutional Source Beutler Lab
Gene Symbol Ppp1r37
Ensembl Gene ENSMUSG00000051403
Gene Nameprotein phosphatase 1, regulatory subunit 37
SynonymsLrrc68
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R7626 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19530800-19563076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19561853 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 60 (I60F)
Ref Sequence ENSEMBL: ENSMUSP00000060233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051364] [ENSMUST00000058444] [ENSMUST00000117222] [ENSMUST00000119912] [ENSMUST00000122055] [ENSMUST00000122127] [ENSMUST00000151646] [ENSMUST00000208826]
Predicted Effect probably benign
Transcript: ENSMUST00000051364
SMART Domains Protein: ENSMUSP00000055844
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000058444
AA Change: I60F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060233
Gene: ENSMUSG00000051403
AA Change: I60F

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
Blast:LRR 139 166 1e-9 BLAST
LRR 224 251 1.77e2 SMART
LRR 252 280 3.52e-1 SMART
LRR 281 308 8.27e-7 SMART
LRR 310 337 3.05e1 SMART
LRR 338 365 1.4e-4 SMART
LRR 366 393 1.56e-2 SMART
LRR 394 421 2.36e-2 SMART
low complexity region 504 540 N/A INTRINSIC
low complexity region 566 574 N/A INTRINSIC
low complexity region 596 628 N/A INTRINSIC
low complexity region 660 679 N/A INTRINSIC
low complexity region 696 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117222
SMART Domains Protein: ENSMUSP00000113266
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119912
SMART Domains Protein: ENSMUSP00000112742
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122055
SMART Domains Protein: ENSMUSP00000113583
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122127
SMART Domains Protein: ENSMUSP00000113709
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151646
SMART Domains Protein: ENSMUSP00000116207
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 81 7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208826
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tll1 T C 8: 64,098,234 probably null Het
Tmem135 A T 7: 89,156,510 probably null Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Ppp1r37
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0313:Ppp1r37 UTSW 7 19533998 missense probably damaging 1.00
R0718:Ppp1r37 UTSW 7 19532254 missense probably benign
R0883:Ppp1r37 UTSW 7 19532177 missense probably benign 0.01
R1606:Ppp1r37 UTSW 7 19534999 missense probably damaging 0.97
R2220:Ppp1r37 UTSW 7 19532446 missense probably null 0.43
R2256:Ppp1r37 UTSW 7 19562018 unclassified probably benign
R2257:Ppp1r37 UTSW 7 19562018 unclassified probably benign
R2325:Ppp1r37 UTSW 7 19532684 missense probably damaging 1.00
R2510:Ppp1r37 UTSW 7 19532432 missense possibly damaging 0.79
R3401:Ppp1r37 UTSW 7 19532787 missense probably damaging 0.99
R3402:Ppp1r37 UTSW 7 19532787 missense probably damaging 0.99
R4006:Ppp1r37 UTSW 7 19535069 missense probably damaging 1.00
R4750:Ppp1r37 UTSW 7 19531520 missense probably benign
R4956:Ppp1r37 UTSW 7 19532711 nonsense probably null
R5156:Ppp1r37 UTSW 7 19561975 unclassified probably benign
R5582:Ppp1r37 UTSW 7 19532294 missense probably damaging 1.00
R5659:Ppp1r37 UTSW 7 19535523 missense probably damaging 1.00
R5918:Ppp1r37 UTSW 7 19532111 missense probably benign 0.02
R6172:Ppp1r37 UTSW 7 19532404 missense possibly damaging 0.93
R6659:Ppp1r37 UTSW 7 19532123 missense probably benign 0.00
R7779:Ppp1r37 UTSW 7 19532787 missense possibly damaging 0.81
R7785:Ppp1r37 UTSW 7 19532071 missense probably damaging 1.00
R7819:Ppp1r37 UTSW 7 19534064 missense probably damaging 1.00
Z1177:Ppp1r37 UTSW 7 19535072 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTAACCTAGGCACCGTTG -3'
(R):5'- TTCGGCTTGTAGCGAAAGTG -3'

Sequencing Primer
(F):5'- TCTAACCTAGGCACCGTTGAAATC -3'
(R):5'- TAGCGAAAGTGTGGCTGC -3'
Posted On2019-10-24