Incidental Mutation 'R7626:Rnf40'
ID589450
Institutional Source Beutler Lab
Gene Symbol Rnf40
Ensembl Gene ENSMUSG00000030816
Gene Namering finger protein 40
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R7626 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127588767-127604799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127589875 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 140 (D140G)
Ref Sequence ENSEMBL: ENSMUSP00000146310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033088] [ENSMUST00000072155] [ENSMUST00000205694] [ENSMUST00000206914]
Predicted Effect probably benign
Transcript: ENSMUST00000033088
AA Change: D140G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000033088
Gene: ENSMUSG00000030816
AA Change: D140G

DomainStartEndE-ValueType
coiled coil region 55 86 N/A INTRINSIC
coiled coil region 189 209 N/A INTRINSIC
coiled coil region 231 377 N/A INTRINSIC
coiled coil region 437 525 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
coiled coil region 629 760 N/A INTRINSIC
coiled coil region 800 839 N/A INTRINSIC
RING 948 986 1.86e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072155
SMART Domains Protein: ENSMUSP00000072019
Gene: ENSMUSG00000057176

DomainStartEndE-ValueType
Pfam:CLAMP 130 228 3.1e-37 PFAM
low complexity region 243 274 N/A INTRINSIC
coiled coil region 285 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205694
AA Change: D140G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000205839
Predicted Effect probably benign
Transcript: ENSMUST00000206914
AA Change: D140G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif known to be involved in protein-protein and protein-DNA interactions. This protein was reported to interact with the tumor suppressor protein RB1. Studies of the rat counterpart suggested that this protein may function as an E3 ubiquitin-protein ligase, and facilitate the ubiquitination and degradation of syntaxin 1, which is an essential component of the neurotransmitter release machinery. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tll1 T C 8: 64,098,234 probably null Het
Tmem135 A T 7: 89,156,510 probably null Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Rnf40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02155:Rnf40 APN 7 127590716 splice site probably benign
IGL02331:Rnf40 APN 7 127589827 missense probably benign
IGL02626:Rnf40 APN 7 127596572 missense probably damaging 1.00
IGL02867:Rnf40 APN 7 127591429 nonsense probably null
IGL02889:Rnf40 APN 7 127591429 nonsense probably null
IGL03353:Rnf40 APN 7 127592891 nonsense probably null
R0103:Rnf40 UTSW 7 127600571 missense probably damaging 1.00
R0103:Rnf40 UTSW 7 127600571 missense probably damaging 1.00
R0133:Rnf40 UTSW 7 127596860 splice site probably null
R0554:Rnf40 UTSW 7 127602584 missense probably damaging 1.00
R0563:Rnf40 UTSW 7 127592876 missense probably damaging 1.00
R1523:Rnf40 UTSW 7 127590615 missense probably damaging 0.99
R1551:Rnf40 UTSW 7 127596334 missense possibly damaging 0.88
R1804:Rnf40 UTSW 7 127595948 missense possibly damaging 0.59
R1929:Rnf40 UTSW 7 127591784 missense probably damaging 0.99
R2194:Rnf40 UTSW 7 127597235 missense probably damaging 1.00
R2356:Rnf40 UTSW 7 127591576 missense probably damaging 0.99
R4839:Rnf40 UTSW 7 127592640 nonsense probably null
R5071:Rnf40 UTSW 7 127597286 missense probably damaging 1.00
R5074:Rnf40 UTSW 7 127597286 missense probably damaging 1.00
R5292:Rnf40 UTSW 7 127595948 missense possibly damaging 0.59
R5537:Rnf40 UTSW 7 127596089 missense probably benign 0.05
R5547:Rnf40 UTSW 7 127589130 critical splice donor site probably null
R5871:Rnf40 UTSW 7 127591585 missense probably damaging 0.97
R6767:Rnf40 UTSW 7 127596585 missense possibly damaging 0.88
R6834:Rnf40 UTSW 7 127596406 missense probably benign 0.18
R6969:Rnf40 UTSW 7 127596323 missense possibly damaging 0.89
R6980:Rnf40 UTSW 7 127594677 missense probably damaging 1.00
R8177:Rnf40 UTSW 7 127596150 missense probably benign
R8719:Rnf40 UTSW 7 127592662 missense not run
R8798:Rnf40 UTSW 7 127589782 missense not run
R8817:Rnf40 UTSW 7 127597160 missense not run
X0026:Rnf40 UTSW 7 127594695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCGTCAACCGCTACTGG -3'
(R):5'- CTTCTACTTTTCAGAAGGCTGGG -3'

Sequencing Primer
(F):5'- TGAAGAGCGAGCGTCCTACTG -3'
(R):5'- TTTAATCCCAGCACTCGGGAG -3'
Posted On2019-10-24