Incidental Mutation 'R7626:Eri1'
ID589451
Institutional Source Beutler Lab
Gene Symbol Eri1
Ensembl Gene ENSMUSG00000031527
Gene Nameexoribonuclease 1
SynonymsEri1, Thex1, 3110010F15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7626 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location35465253-35496196 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 35474400 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 264 (Y264*)
Ref Sequence ENSEMBL: ENSMUSP00000033927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033927]
Predicted Effect probably null
Transcript: ENSMUST00000033927
AA Change: Y264*
SMART Domains Protein: ENSMUSP00000033927
Gene: ENSMUSG00000031527
AA Change: Y264*

DomainStartEndE-ValueType
SAP 72 106 1.24e-5 SMART
EXOIII 125 311 4.63e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, decreased body size beginning at E15.5, and decreased proliferation of mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Eri1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Eri1 APN 8 35482682 missense possibly damaging 0.53
IGL00990:Eri1 APN 8 35482646 missense probably benign
IGL01732:Eri1 APN 8 35491243 missense possibly damaging 0.85
R1467:Eri1 UTSW 8 35469130 makesense probably null
R1467:Eri1 UTSW 8 35469130 makesense probably null
R1496:Eri1 UTSW 8 35469181 missense possibly damaging 0.92
R2431:Eri1 UTSW 8 35476478 missense probably damaging 1.00
R3862:Eri1 UTSW 8 35491294 missense possibly damaging 0.85
R4330:Eri1 UTSW 8 35469229 nonsense probably null
R4831:Eri1 UTSW 8 35476519 missense possibly damaging 0.92
R5524:Eri1 UTSW 8 35478609 missense probably benign 0.00
R6594:Eri1 UTSW 8 35482533 missense probably damaging 1.00
R7043:Eri1 UTSW 8 35478638 missense probably damaging 0.99
R7101:Eri1 UTSW 8 35482623 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTCCTGTAGGGAGAAAGAACC -3'
(R):5'- ATGAGCTTAGTAAGAAGAGTTTGCG -3'

Sequencing Primer
(F):5'- CTCCTCCATGGGCATCAGGTATG -3'
(R):5'- GCGAAGAAAATACTGCTTTTTCCCC -3'
Posted On2019-10-24