Incidental Mutation 'R7626:Ces2b'
ID589452
Institutional Source Beutler Lab
Gene Symbol Ces2b
Ensembl Gene ENSMUSG00000050097
Gene Namecarboxyesterase 2B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7626 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location104831572-104840093 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104837385 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 464 (Y464H)
Ref Sequence ENSEMBL: ENSMUSP00000063005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059449] [ENSMUST00000163042]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059449
AA Change: Y464H

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063005
Gene: ENSMUSG00000050097
AA Change: Y464H

DomainStartEndE-ValueType
Pfam:COesterase 10 535 8.5e-175 PFAM
Pfam:Abhydrolase_3 140 305 1.8e-11 PFAM
Pfam:Peptidase_S9 161 296 9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163042
SMART Domains Protein: ENSMUSP00000124796
Gene: ENSMUSG00000050097

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tll1 T C 8: 64,098,234 probably null Het
Tmem135 A T 7: 89,156,510 probably null Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Ces2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Ces2b APN 8 104834604 splice site probably benign
IGL01905:Ces2b APN 8 104833962 missense probably damaging 1.00
IGL02528:Ces2b APN 8 104834969 missense probably damaging 1.00
IGL02659:Ces2b APN 8 104832570 splice site probably benign
IGL02885:Ces2b APN 8 104834931 missense probably damaging 1.00
PIT4142001:Ces2b UTSW 8 104836810 missense probably damaging 1.00
R0092:Ces2b UTSW 8 104836512 missense possibly damaging 0.48
R0403:Ces2b UTSW 8 104833945 missense probably damaging 0.98
R0600:Ces2b UTSW 8 104835910 missense probably benign 0.06
R0637:Ces2b UTSW 8 104834605 splice site probably benign
R1574:Ces2b UTSW 8 104835889 missense probably benign 0.16
R1574:Ces2b UTSW 8 104835889 missense probably benign 0.16
R3036:Ces2b UTSW 8 104834626 missense possibly damaging 0.87
R3086:Ces2b UTSW 8 104832769 missense possibly damaging 0.92
R4761:Ces2b UTSW 8 104836561 critical splice donor site probably null
R4920:Ces2b UTSW 8 104836906 missense probably benign
R4937:Ces2b UTSW 8 104832781 missense probably benign 0.29
R5211:Ces2b UTSW 8 104835063 missense possibly damaging 0.89
R5550:Ces2b UTSW 8 104838437 missense probably benign 0.00
R5790:Ces2b UTSW 8 104833936 missense probably damaging 1.00
R6403:Ces2b UTSW 8 104836269 nonsense probably null
R6692:Ces2b UTSW 8 104837287 missense probably damaging 1.00
R6720:Ces2b UTSW 8 104836869 missense probably benign 0.32
R6899:Ces2b UTSW 8 104836766 splice site probably null
R7148:Ces2b UTSW 8 104838296 missense probably damaging 1.00
R7270:Ces2b UTSW 8 104837840 missense possibly damaging 0.50
R7571:Ces2b UTSW 8 104835009 missense probably damaging 1.00
R7841:Ces2b UTSW 8 104835060 missense probably benign 0.19
R7892:Ces2b UTSW 8 104832753 missense probably damaging 1.00
R8029:Ces2b UTSW 8 104834850 missense probably damaging 1.00
R8293:Ces2b UTSW 8 104832626 missense unknown
R8296:Ces2b UTSW 8 104836480 missense possibly damaging 0.77
R8721:Ces2b UTSW 8 104833895 missense possibly damaging 0.88
X0027:Ces2b UTSW 8 104833928 missense probably damaging 1.00
Z1177:Ces2b UTSW 8 104832595 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTGGAGGCTAACTCTCCATTTAAC -3'
(R):5'- TCCAAGCTGGGCATGGTTTG -3'

Sequencing Primer
(F):5'- CTCCATTTAACTTCTATGATTCAGGG -3'
(R):5'- TGGTTTGGGGAAAATAATATGGTAC -3'
Posted On2019-10-24