Incidental Mutation 'R7626:Dcn'
ID589456
Institutional Source Beutler Lab
Gene Symbol Dcn
Ensembl Gene ENSMUSG00000019929
Gene Namedecorin
SynonymsDC, SLRR1B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7626 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location97479609-97518143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97483478 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 39 (Y39C)
Ref Sequence ENSEMBL: ENSMUSP00000100924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105287] [ENSMUST00000163448] [ENSMUST00000219784]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105287
AA Change: Y39C

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100924
Gene: ENSMUSG00000019929
AA Change: Y39C

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
LRRNT 48 80 3.86e-11 SMART
LRR 79 98 2.54e1 SMART
LRR 99 122 1.14e0 SMART
LRR_TYP 123 146 2.91e-2 SMART
LRR 147 167 1.67e2 SMART
LRR 168 193 1.29e2 SMART
LRR 194 217 5.27e1 SMART
LRR 239 262 6.05e0 SMART
LRR 263 286 1.01e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163448
AA Change: Y39C

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131431
Gene: ENSMUSG00000019929
AA Change: Y39C

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
LRRNT 48 80 3.86e-11 SMART
LRR 79 98 2.54e1 SMART
LRR 99 122 1.14e0 SMART
LRR_TYP 123 146 2.91e-2 SMART
LRR 147 167 1.67e2 SMART
LRR 168 193 1.29e2 SMART
LRR 194 217 5.27e1 SMART
LRR 239 262 6.05e0 SMART
LRR 263 286 1.01e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219784
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family of proteins. The encoded preproprotein is proteolytically processed to generate a mature protein product, which is secreted into the extracellular space to regulate collagen fibril assembly. Homozygous knockout mice for this gene exhibit enhanced tumorigenesis in a liver cancer model, and defects in collagen fibrils, leading to weakened skin and tendons. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mutant mice have fragile skin and exhibit abnormal collagen morphology in skin and tendons, supporting this gene's role in regulating collagen fiber formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tll1 T C 8: 64,098,234 probably null Het
Tmem135 A T 7: 89,156,510 probably null Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Dcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Dcn APN 10 97483523 missense probably damaging 1.00
IGL01776:Dcn APN 10 97495076 missense possibly damaging 0.88
IGL02608:Dcn APN 10 97483457 missense probably damaging 0.99
IGL02990:Dcn APN 10 97509973 missense probably benign 0.00
IGL03181:Dcn APN 10 97483452 missense probably damaging 0.98
IGL03268:Dcn APN 10 97483378 missense probably benign
PIT4791001:Dcn UTSW 10 97507742 missense probably benign
R0091:Dcn UTSW 10 97506689 missense probably benign 0.00
R0267:Dcn UTSW 10 97506483 splice site probably benign
R1759:Dcn UTSW 10 97513655 missense probably benign 0.01
R1845:Dcn UTSW 10 97506674 missense probably benign 0.00
R5322:Dcn UTSW 10 97517602 missense probably benign 0.03
R6613:Dcn UTSW 10 97495040 missense probably benign 0.03
R6650:Dcn UTSW 10 97507743 missense probably benign 0.00
R7392:Dcn UTSW 10 97509998 missense probably damaging 0.98
R7596:Dcn UTSW 10 97510009 missense probably damaging 1.00
R7957:Dcn UTSW 10 97510194 intron probably null
R8049:Dcn UTSW 10 97513617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCCTTGCTCAGAAACCC -3'
(R):5'- AAAGCCTAAAGTGTCCTAGCCTC -3'

Sequencing Primer
(F):5'- TGCTCAGAAACCCTTCTCTTTG -3'
(R):5'- CTCTTACTTCTGGAATTGCAGAGATG -3'
Posted On2019-10-24