Incidental Mutation 'R7626:Olfr325'
ID589458
Institutional Source Beutler Lab
Gene Symbol Olfr325
Ensembl Gene ENSMUSG00000060765
Gene Nameolfactory receptor 325
SynonymsMOR275-5, MOR275-11_p, GA_x6K02T2NKPP-844642-843680
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7626 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58577730-58582365 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 58581173 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 110 (T110P)
Ref Sequence ENSEMBL: ENSMUSP00000145386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169428] [ENSMUST00000203418]
Predicted Effect probably damaging
Transcript: ENSMUST00000169428
AA Change: T110P

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131257
Gene: ENSMUSG00000060765
AA Change: T110P

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 2.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 39 290 1.4e-6 PFAM
Pfam:7tm_1 45 294 1.6e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203418
AA Change: T110P

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145386
Gene: ENSMUSG00000060765
AA Change: T110P

DomainStartEndE-ValueType
Pfam:7tm_4 35 130 7.6e-14 PFAM
Pfam:7TM_GPCR_Srsx 36 130 1.1e-4 PFAM
Pfam:7tm_1 45 130 2.6e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tll1 T C 8: 64,098,234 probably null Het
Tmem135 A T 7: 89,156,510 probably null Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Olfr325
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Olfr325 APN 11 58581810 missense probably benign
IGL01922:Olfr325 APN 11 58581073 missense probably benign 0.01
IGL02440:Olfr325 APN 11 58581209 missense probably damaging 1.00
IGL02456:Olfr325 APN 11 58581198 missense possibly damaging 0.48
IGL03088:Olfr325 APN 11 58581827 utr 3 prime probably benign
IGL03328:Olfr325 APN 11 58581713 missense probably damaging 1.00
R0604:Olfr325 UTSW 11 58581348 missense probably damaging 0.99
R1698:Olfr325 UTSW 11 58581251 missense probably damaging 1.00
R2473:Olfr325 UTSW 11 58581575 missense probably damaging 1.00
R2888:Olfr325 UTSW 11 58581162 missense possibly damaging 0.96
R4133:Olfr325 UTSW 11 58581075 missense probably damaging 0.97
R4710:Olfr325 UTSW 11 58581722 missense probably damaging 1.00
R4715:Olfr325 UTSW 11 58581429 missense probably damaging 1.00
R4898:Olfr325 UTSW 11 58581720 missense probably damaging 1.00
R4939:Olfr325 UTSW 11 58581211 missense probably damaging 1.00
R4977:Olfr325 UTSW 11 58581629 missense possibly damaging 0.57
R5389:Olfr325 UTSW 11 58580999 missense possibly damaging 0.78
R5393:Olfr325 UTSW 11 58580999 missense possibly damaging 0.78
R6137:Olfr325 UTSW 11 58581068 missense probably benign
R6302:Olfr325 UTSW 11 58581638 missense probably benign
R6655:Olfr325 UTSW 11 58581210 missense probably damaging 1.00
R6927:Olfr325 UTSW 11 58581665 missense possibly damaging 0.81
R7451:Olfr325 UTSW 11 58581690 missense probably damaging 1.00
R7494:Olfr325 UTSW 11 58581212 missense probably damaging 0.97
R7724:Olfr325 UTSW 11 58581382 missense probably benign 0.01
R7874:Olfr325 UTSW 11 58581747 missense possibly damaging 0.93
R8217:Olfr325 UTSW 11 58580966 missense probably benign 0.00
R8252:Olfr325 UTSW 11 58581132 missense probably damaging 1.00
Z1177:Olfr325 UTSW 11 58581311 missense probably damaging 1.00
Z1186:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1186:Olfr325 UTSW 11 58580931 missense probably benign
Z1186:Olfr325 UTSW 11 58581002 missense probably benign
Z1186:Olfr325 UTSW 11 58581296 missense probably benign
Z1186:Olfr325 UTSW 11 58581657 missense probably benign
Z1187:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1187:Olfr325 UTSW 11 58580931 missense probably benign
Z1187:Olfr325 UTSW 11 58581002 missense probably benign
Z1187:Olfr325 UTSW 11 58581296 missense probably benign
Z1187:Olfr325 UTSW 11 58581657 missense probably benign
Z1188:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1188:Olfr325 UTSW 11 58580931 missense probably benign
Z1188:Olfr325 UTSW 11 58581002 missense probably benign
Z1188:Olfr325 UTSW 11 58581296 missense probably benign
Z1188:Olfr325 UTSW 11 58581657 missense probably benign
Z1189:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1189:Olfr325 UTSW 11 58580931 missense probably benign
Z1189:Olfr325 UTSW 11 58581296 missense probably benign
Z1189:Olfr325 UTSW 11 58581657 missense probably benign
Z1190:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1190:Olfr325 UTSW 11 58580931 missense probably benign
Z1190:Olfr325 UTSW 11 58581002 missense probably benign
Z1190:Olfr325 UTSW 11 58581296 missense probably benign
Z1190:Olfr325 UTSW 11 58581657 missense probably benign
Z1191:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1191:Olfr325 UTSW 11 58580931 missense probably benign
Z1191:Olfr325 UTSW 11 58581002 missense probably benign
Z1191:Olfr325 UTSW 11 58581296 missense probably benign
Z1191:Olfr325 UTSW 11 58581657 missense probably benign
Z1192:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1192:Olfr325 UTSW 11 58580931 missense probably benign
Z1192:Olfr325 UTSW 11 58581296 missense probably benign
Z1192:Olfr325 UTSW 11 58581657 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTACTCTCTGACACCCAC -3'
(R):5'- TTTGTCACAGCAGGAACCTC -3'

Sequencing Primer
(F):5'- GTACTCTCTGACACCCACCTTCAC -3'
(R):5'- AAGTGATGGATCTCCCGGGATC -3'
Posted On2019-10-24