Incidental Mutation 'R7626:Tbx2'
ID589460
Institutional Source Beutler Lab
Gene Symbol Tbx2
Ensembl Gene ENSMUSG00000000093
Gene NameT-box 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7626 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location85832551-85841948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85840796 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 640 (T640A)
Ref Sequence ENSEMBL: ENSMUSP00000000095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000095]
Predicted Effect probably benign
Transcript: ENSMUST00000000095
AA Change: T640A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000000095
Gene: ENSMUSG00000000093
AA Change: T640A

DomainStartEndE-ValueType
low complexity region 28 75 N/A INTRINSIC
TBOX 104 292 2.44e-130 SMART
Pfam:TBX 305 382 1.5e-18 PFAM
low complexity region 391 408 N/A INTRINSIC
low complexity region 509 549 N/A INTRINSIC
SCOP:d1gkub1 582 612 5e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene product is the human homolog of mouse Tbx2, and shares strong sequence similarity with Drosophila omb protein. Expression studies indicate that this gene may have a potential role in tumorigenesis as an immortalizing agent. Transcript heterogeneity due to alternative polyadenylation has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal cardiac and vascular development, edema, and polydactyly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Tbx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02499:Tbx2 APN 11 85840913 missense possibly damaging 0.82
PIT4480001:Tbx2 UTSW 11 85834735 missense probably damaging 1.00
R1295:Tbx2 UTSW 11 85834766 missense probably damaging 0.97
R1296:Tbx2 UTSW 11 85834766 missense probably damaging 0.97
R1384:Tbx2 UTSW 11 85833492 missense probably benign 0.01
R1501:Tbx2 UTSW 11 85834796 missense probably damaging 1.00
R3949:Tbx2 UTSW 11 85838275 nonsense probably null
R4451:Tbx2 UTSW 11 85840817 missense probably damaging 1.00
R5214:Tbx2 UTSW 11 85838437 missense probably benign 0.02
R5690:Tbx2 UTSW 11 85837053 missense probably damaging 1.00
R6186:Tbx2 UTSW 11 85837846 nonsense probably null
R7211:Tbx2 UTSW 11 85834714 missense probably damaging 1.00
R7353:Tbx2 UTSW 11 85833489 missense probably damaging 0.96
R7529:Tbx2 UTSW 11 85840901 missense probably benign 0.02
R7573:Tbx2 UTSW 11 85833312 missense possibly damaging 0.70
R7762:Tbx2 UTSW 11 85835901 missense probably damaging 1.00
R7996:Tbx2 UTSW 11 85834790 missense not run
Predicted Primers PCR Primer
(F):5'- AATCCCAATGCCCACTTTCG -3'
(R):5'- CTGTACACGTCCTAGACAGC -3'

Sequencing Primer
(F):5'- GTACACTTACATGGCAGCAGCG -3'
(R):5'- AAGCAGCCCCTCACTTGG -3'
Posted On2019-10-24