Incidental Mutation 'R7626:Mmd'
ID589461
Institutional Source Beutler Lab
Gene Symbol Mmd
Ensembl Gene ENSMUSG00000003948
Gene Namemonocyte to macrophage differentiation-associated
Synonyms1200017E07Rik, 1810073C06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7626 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location90249456-90278589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 90257552 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 20 (R20L)
Ref Sequence ENSEMBL: ENSMUSP00000004050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004050] [ENSMUST00000107887]
Predicted Effect probably damaging
Transcript: ENSMUST00000004050
AA Change: R20L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004050
Gene: ENSMUSG00000003948
AA Change: R20L

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:HlyIII 24 220 9.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107887
AA Change: R20L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103519
Gene: ENSMUSG00000003948
AA Change: R20L

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:HlyIII 23 179 8.8e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is expressed by in vitro differentiated macrophages but not freshly isolated monocytes. Although sequence analysis identifies seven potential transmembrane domains, this protein has little homology to G-protein receptors and it has not been positively identified as a receptor. A suggested alternative function is that of an ion channel protein in maturing macrophages. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tll1 T C 8: 64,098,234 probably null Het
Tmem135 A T 7: 89,156,510 probably null Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Mmd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Mmd APN 11 90264534 missense probably damaging 1.00
IGL01300:Mmd APN 11 90249711 start codon destroyed probably null
IGL03412:Mmd APN 11 90257603 critical splice donor site probably null
R0052:Mmd UTSW 11 90259998 splice site probably benign
R0052:Mmd UTSW 11 90259998 splice site probably benign
R1342:Mmd UTSW 11 90276850 missense probably benign 0.03
R3084:Mmd UTSW 11 90266085 missense probably damaging 1.00
R6969:Mmd UTSW 11 90257536 missense probably damaging 1.00
R7079:Mmd UTSW 11 90267499 splice site probably null
R7638:Mmd UTSW 11 90276757 missense possibly damaging 0.80
R7734:Mmd UTSW 11 90276753 missense probably damaging 1.00
R7838:Mmd UTSW 11 90267607 missense probably benign 0.38
Z1177:Mmd UTSW 11 90259888 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGAGCAAACTCAAAGGCTGTTTC -3'
(R):5'- CACTTAAGGTCACCAGGCTG -3'

Sequencing Primer
(F):5'- ATTCAGTGCTGCTGGCCAAG -3'
(R):5'- CAGGCTGAGTAGTTCCAACAACTTG -3'
Posted On2019-10-24