Incidental Mutation 'R7626:Hbp1'
ID589463
Institutional Source Beutler Lab
Gene Symbol Hbp1
Ensembl Gene ENSMUSG00000002996
Gene Namehigh mobility group box transcription factor 1
Synonyms1700058O05Rik, C86454, C330012F01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.752) question?
Stock #R7626 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location31926254-31950535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31943900 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 43 (E43G)
Ref Sequence ENSEMBL: ENSMUSP00000131158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167458] [ENSMUST00000172314] [ENSMUST00000175686] [ENSMUST00000176084] [ENSMUST00000176103] [ENSMUST00000176520]
Predicted Effect probably benign
Transcript: ENSMUST00000167458
AA Change: E43G

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131983
Gene: ENSMUSG00000002996
AA Change: E43G

DomainStartEndE-ValueType
low complexity region 162 176 N/A INTRINSIC
AXH 220 350 1.35e-88 SMART
PDB:1S5R|A 368 390 6e-7 PDB
low complexity region 406 424 N/A INTRINSIC
PDB:2E6O|A 437 474 6e-20 PDB
SCOP:d1cg7a_ 443 474 2e-9 SMART
Blast:HMG 445 474 3e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172314
AA Change: E43G

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131158
Gene: ENSMUSG00000002996
AA Change: E43G

DomainStartEndE-ValueType
low complexity region 162 176 N/A INTRINSIC
AXH 220 350 1.35e-88 SMART
PDB:1S5R|A 368 390 7e-7 PDB
low complexity region 406 424 N/A INTRINSIC
HMG 445 515 8.7e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175686
AA Change: E47G

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135080
Gene: ENSMUSG00000002996
AA Change: E47G

DomainStartEndE-ValueType
low complexity region 166 180 N/A INTRINSIC
AXH 224 354 1.35e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176084
AA Change: E33G

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135489
Gene: ENSMUSG00000002996
AA Change: E33G

DomainStartEndE-ValueType
low complexity region 152 166 N/A INTRINSIC
PDB:3QVE|C 206 230 7e-10 PDB
Blast:AXH 210 230 2e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000176103
AA Change: E43G

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135508
Gene: ENSMUSG00000002996
AA Change: E43G

DomainStartEndE-ValueType
low complexity region 162 176 N/A INTRINSIC
PDB:1V06|A 218 265 1e-28 PDB
Blast:AXH 220 265 1e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000176520
AA Change: E33G

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135155
Gene: ENSMUSG00000002996
AA Change: E33G

DomainStartEndE-ValueType
low complexity region 152 166 N/A INTRINSIC
Pfam:AXH 215 288 3.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176643
Meta Mutation Damage Score 0.0823 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice heterozygous for a gene trapped allele have behavioral abnormalities and show alterations in leukocyte, platelet and NK cell number, blood urea nitrogen levels, and circulating amylase and calcium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tll1 T C 8: 64,098,234 probably null Het
Tmem135 A T 7: 89,156,510 probably null Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Hbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Hbp1 APN 12 31930675 unclassified probably benign
Sliver UTSW 12 31937247 missense probably damaging 0.99
R4135:Hbp1 UTSW 12 31934422 missense probably damaging 1.00
R4569:Hbp1 UTSW 12 31950232 unclassified probably benign
R5324:Hbp1 UTSW 12 31928618 missense probably damaging 1.00
R5910:Hbp1 UTSW 12 31937652 missense probably benign 0.19
R5936:Hbp1 UTSW 12 31937096 splice site probably null
R6062:Hbp1 UTSW 12 31937247 missense probably damaging 0.99
R6439:Hbp1 UTSW 12 31937721 missense probably damaging 1.00
R7017:Hbp1 UTSW 12 31943853 missense probably damaging 1.00
R7213:Hbp1 UTSW 12 31937197 missense probably benign 0.00
R7519:Hbp1 UTSW 12 31933375 missense probably damaging 1.00
R7731:Hbp1 UTSW 12 31933368 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACATGCTACACCTGCACCTG -3'
(R):5'- AGTGCTGACCTACTGACTGAC -3'

Sequencing Primer
(F):5'- ACACACTCAGAACAGAAAGAATATG -3'
(R):5'- GACCTACTGACTGACTTTTTATGTG -3'
Posted On2019-10-24