Incidental Mutation 'R7626:Degs2'
ID589464
Institutional Source Beutler Lab
Gene Symbol Degs2
Ensembl Gene ENSMUSG00000021263
Gene Namedelta(4)-desaturase, sphingolipid 2
SynonymsDes2, 2210008A03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7626 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location108678711-108702315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108692073 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 216 (S216G)
Ref Sequence ENSEMBL: ENSMUSP00000021691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021689] [ENSMUST00000021691] [ENSMUST00000077735] [ENSMUST00000109854] [ENSMUST00000167978] [ENSMUST00000172409]
Predicted Effect probably benign
Transcript: ENSMUST00000021689
SMART Domains Protein: ENSMUSP00000021689
Gene: ENSMUSG00000021262

DomainStartEndE-ValueType
WH1 1 109 7.72e-53 SMART
low complexity region 172 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
Pfam:VASP_tetra 375 411 2.6e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000021691
AA Change: S216G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021691
Gene: ENSMUSG00000021263
AA Change: S216G

DomainStartEndE-ValueType
Lipid_DES 5 43 5.57e-18 SMART
Pfam:FA_desaturase 65 294 3.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077735
SMART Domains Protein: ENSMUSP00000076916
Gene: ENSMUSG00000021262

DomainStartEndE-ValueType
WH1 1 109 7.72e-53 SMART
low complexity region 172 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
Pfam:VASP_tetra 353 392 2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109854
SMART Domains Protein: ENSMUSP00000105480
Gene: ENSMUSG00000021262

DomainStartEndE-ValueType
WH1 7 115 1.87e-51 SMART
low complexity region 178 210 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
Pfam:VASP_tetra 359 398 7.1e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167978
AA Change: S216G

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125891
Gene: ENSMUSG00000021263
AA Change: S216G

DomainStartEndE-ValueType
Lipid_DES 5 43 5.57e-18 SMART
Pfam:FA_desaturase 64 275 1.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172409
SMART Domains Protein: ENSMUSP00000133072
Gene: ENSMUSG00000021262

DomainStartEndE-ValueType
WH1 1 96 5.82e-39 SMART
low complexity region 159 191 N/A INTRINSIC
low complexity region 203 215 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
Pfam:VASP_tetra 361 400 1.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222255
AA Change: S37G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000223548
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bifunctional enzyme that is involved in the biosynthesis of phytosphingolipids in human skin and in other phytosphingolipid-containing tissues. This enzyme can act as a sphingolipid delta(4)-desaturase, and also as a sphingolipid C4-hydroxylase. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Degs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02407:Degs2 APN 12 108691995 missense probably damaging 1.00
IGL02755:Degs2 APN 12 108692583 missense probably benign
largo UTSW 12 108692154 missense probably damaging 1.00
R0039:Degs2 UTSW 12 108690589 missense probably damaging 1.00
R0044:Degs2 UTSW 12 108692154 missense probably damaging 1.00
R0044:Degs2 UTSW 12 108692154 missense probably damaging 1.00
R0441:Degs2 UTSW 12 108702214 missense probably damaging 0.97
R1642:Degs2 UTSW 12 108692192 missense probably benign
R4183:Degs2 UTSW 12 108692099 missense probably damaging 1.00
R4817:Degs2 UTSW 12 108689066 nonsense probably null
R6268:Degs2 UTSW 12 108692580 missense probably damaging 1.00
R6863:Degs2 UTSW 12 108702202 missense probably damaging 1.00
R7839:Degs2 UTSW 12 108692201 frame shift probably null
R7922:Degs2 UTSW 12 108692201 frame shift probably null
Z1177:Degs2 UTSW 12 108692597 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TTACCAGTGGCAGGTAGTAAC -3'
(R):5'- TATTCCTACGAACTTCGAGGGC -3'

Sequencing Primer
(F):5'- CCGGGGATACTGGGGAAGTC -3'
(R):5'- ACGAACTTCGAGGGCTGGTTC -3'
Posted On2019-10-24