Incidental Mutation 'R7626:Rhobtb2'
ID589468
Institutional Source Beutler Lab
Gene Symbol Rhobtb2
Ensembl Gene ENSMUSG00000022075
Gene NameRho-related BTB domain containing 2
SynonymsDbc2, E130206H14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7626 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location69784990-69805636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69796937 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 280 (A280S)
Ref Sequence ENSEMBL: ENSMUSP00000022665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022665]
Predicted Effect probably damaging
Transcript: ENSMUST00000022665
AA Change: A280S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022665
Gene: ENSMUSG00000022075
AA Change: A280S

DomainStartEndE-ValueType
RHO 17 210 4.86e-36 SMART
low complexity region 227 249 N/A INTRINSIC
BTB 266 472 5.27e-15 SMART
BTB 500 598 2.78e-14 SMART
low complexity region 706 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a small Rho GTPase and a candidate tumor suppressor. The encoded protein interacts with the cullin-3 protein, a ubiquitin E3 ligase necessary for mitotic cell division. This protein inhibits the growth and spread of some types of breast cancer. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tll1 T C 8: 64,098,234 probably null Het
Tmem135 A T 7: 89,156,510 probably null Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Rhobtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Rhobtb2 APN 14 69796588 missense possibly damaging 0.82
IGL02437:Rhobtb2 APN 14 69795916 missense probably damaging 1.00
Paunchy UTSW 14 69798178 missense probably damaging 1.00
reeses UTSW 14 69799711 missense probably damaging 1.00
smoke UTSW 14 69796444 missense probably damaging 0.99
waft UTSW 14 69796735 missense probably benign 0.22
R0034:Rhobtb2 UTSW 14 69788688 missense probably benign
R0149:Rhobtb2 UTSW 14 69795908 missense probably benign 0.02
R0361:Rhobtb2 UTSW 14 69795908 missense probably benign 0.02
R0376:Rhobtb2 UTSW 14 69796735 missense probably benign 0.22
R0594:Rhobtb2 UTSW 14 69793948 missense probably benign
R1005:Rhobtb2 UTSW 14 69798277 missense probably damaging 1.00
R1072:Rhobtb2 UTSW 14 69787527 small deletion probably benign
R1929:Rhobtb2 UTSW 14 69796444 missense probably damaging 0.99
R1938:Rhobtb2 UTSW 14 69796613 missense probably benign 0.01
R2058:Rhobtb2 UTSW 14 69794039 missense possibly damaging 0.49
R2244:Rhobtb2 UTSW 14 69787527 small deletion probably benign
R2992:Rhobtb2 UTSW 14 69798323 missense probably damaging 1.00
R3953:Rhobtb2 UTSW 14 69794039 missense possibly damaging 0.49
R4655:Rhobtb2 UTSW 14 69795989 missense probably damaging 0.97
R4712:Rhobtb2 UTSW 14 69799711 missense probably damaging 1.00
R4744:Rhobtb2 UTSW 14 69794002 missense probably damaging 1.00
R4771:Rhobtb2 UTSW 14 69797050 missense probably benign 0.20
R5648:Rhobtb2 UTSW 14 69797144 missense probably damaging 1.00
R5990:Rhobtb2 UTSW 14 69796369 missense probably damaging 1.00
R6166:Rhobtb2 UTSW 14 69798178 missense probably damaging 1.00
R6186:Rhobtb2 UTSW 14 69798244 missense probably damaging 1.00
R7448:Rhobtb2 UTSW 14 69795948 nonsense probably null
R7591:Rhobtb2 UTSW 14 69799741 missense possibly damaging 0.61
R7793:Rhobtb2 UTSW 14 69796831 missense probably benign 0.01
R7898:Rhobtb2 UTSW 14 69796297 missense probably damaging 1.00
R7981:Rhobtb2 UTSW 14 69796297 missense probably damaging 1.00
R8026:Rhobtb2 UTSW 14 69796765 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CACATACGTCAAAGCTGGC -3'
(R):5'- TTCTGGAAATCACATCTGCGC -3'

Sequencing Primer
(F):5'- AAAGCTGGCTGCCCGAAG -3'
(R):5'- TGGAAATCACATCTGCGCAATGTG -3'
Posted On2019-10-24