Incidental Mutation 'R7626:Satb1'
ID589473
Institutional Source Beutler Lab
Gene Symbol Satb1
Ensembl Gene ENSMUSG00000023927
Gene Namespecial AT-rich sequence binding protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7626 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location51736187-51833290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51767967 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 500 (D500E)
Ref Sequence ENSEMBL: ENSMUSP00000116006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129667] [ENSMUST00000133574] [ENSMUST00000140979] [ENSMUST00000144331] [ENSMUST00000152830] [ENSMUST00000169480] [ENSMUST00000176669]
Predicted Effect probably benign
Transcript: ENSMUST00000129667
AA Change: D500E

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116020
Gene: ENSMUSG00000023927
AA Change: D500E

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 619 N/A INTRINSIC
HOX 644 707 6.73e-10 SMART
low complexity region 720 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133574
AA Change: D500E

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120536
Gene: ENSMUSG00000023927
AA Change: D500E

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000140979
AA Change: D500E

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118839
Gene: ENSMUSG00000023927
AA Change: D500E

DomainStartEndE-ValueType
Pfam:ULD 72 170 3.2e-40 PFAM
Pfam:CUTL 176 247 1.6e-46 PFAM
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 616 661 N/A INTRINSIC
HOX 676 739 6.73e-10 SMART
low complexity region 752 762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144331
AA Change: D500E

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116006
Gene: ENSMUSG00000023927
AA Change: D500E

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152830
AA Change: D500E

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119842
Gene: ENSMUSG00000023927
AA Change: D500E

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169480
AA Change: D500E

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128841
Gene: ENSMUSG00000023927
AA Change: D500E

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176669
AA Change: D500E

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134957
Gene: ENSMUSG00000023927
AA Change: D500E

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a matrix protein which binds nuclear matrix and scaffold-associating DNAs through a unique nuclear architecture. The protein recruits chromatin-remodeling factors in order to regulate chromatin structure and gene expression. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mice for a targeted null mutation exhibit reduced size of the lymphoid organs, abnormal T cell development, general growth retardation and die by 3-4 weeks of age. Mice homozegous for a different targeted allele exhibit postnatal growth retardation and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Satb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Satb1 APN 17 51805289 missense probably damaging 1.00
IGL01658:Satb1 APN 17 51775251 missense probably benign 0.33
IGL02070:Satb1 APN 17 51740067 missense probably damaging 0.98
IGL02212:Satb1 APN 17 51775291 missense possibly damaging 0.82
IGL02971:Satb1 APN 17 51742689 missense possibly damaging 0.62
R0049:Satb1 UTSW 17 51740346 missense probably benign 0.28
R0056:Satb1 UTSW 17 51740203 missense probably damaging 1.00
R0060:Satb1 UTSW 17 51740203 missense probably damaging 1.00
R0067:Satb1 UTSW 17 51804336 missense probably damaging 1.00
R0067:Satb1 UTSW 17 51804336 missense probably damaging 1.00
R0113:Satb1 UTSW 17 51782698 nonsense probably null
R0347:Satb1 UTSW 17 51739906 nonsense probably null
R0667:Satb1 UTSW 17 51782861 missense probably damaging 1.00
R1436:Satb1 UTSW 17 51804363 unclassified probably null
R1595:Satb1 UTSW 17 51782701 missense possibly damaging 0.82
R1686:Satb1 UTSW 17 51739999 missense probably benign 0.08
R1921:Satb1 UTSW 17 51742115 nonsense probably null
R1952:Satb1 UTSW 17 51740145 missense probably damaging 1.00
R2012:Satb1 UTSW 17 51782788 nonsense probably null
R2156:Satb1 UTSW 17 51740410 missense probably benign 0.02
R2180:Satb1 UTSW 17 51803496 missense probably damaging 0.96
R2959:Satb1 UTSW 17 51775303 missense possibly damaging 0.91
R3107:Satb1 UTSW 17 51782782 missense possibly damaging 0.95
R3108:Satb1 UTSW 17 51782782 missense possibly damaging 0.95
R3814:Satb1 UTSW 17 51782907 missense probably damaging 0.98
R4109:Satb1 UTSW 17 51804350 missense probably damaging 0.99
R4727:Satb1 UTSW 17 51804347 missense probably damaging 1.00
R5209:Satb1 UTSW 17 51809207 missense probably benign 0.26
R5652:Satb1 UTSW 17 51742795 missense probably damaging 1.00
R5815:Satb1 UTSW 17 51782953 missense possibly damaging 0.92
R6141:Satb1 UTSW 17 51775376 missense possibly damaging 0.93
R6370:Satb1 UTSW 17 51782797 missense possibly damaging 0.94
R7371:Satb1 UTSW 17 51782980 nonsense probably null
R7409:Satb1 UTSW 17 51809189 missense possibly damaging 0.90
R7471:Satb1 UTSW 17 51783001 missense probably damaging 0.96
R7568:Satb1 UTSW 17 51782724 missense possibly damaging 0.88
R7749:Satb1 UTSW 17 51767933 missense possibly damaging 0.70
R7863:Satb1 UTSW 17 51805322 missense possibly damaging 0.91
R7946:Satb1 UTSW 17 51805322 missense possibly damaging 0.91
Z1088:Satb1 UTSW 17 51782939 missense probably damaging 0.99
Z1088:Satb1 UTSW 17 51782952 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGTCCTGGAGGCTTCAACC -3'
(R):5'- TGACCGCACTGTTGATCAC -3'

Sequencing Primer
(F):5'- AGGCTTCAACCTCTCTGTGATG -3'
(R):5'- CCTTGATCATAAAAGGAGTAACGCTG -3'
Posted On2019-10-24