Incidental Mutation 'R7626:Olfr1495'
ID589477
Institutional Source Beutler Lab
Gene Symbol Olfr1495
Ensembl Gene ENSMUSG00000047207
Gene Nameolfactory receptor 1495
SynonymsGA_x6K02T2RE5P-4101369-4102328, MOR266-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7626 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location13764606-13770248 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to G at 13768345 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 1 (M1R)
Ref Sequence ENSEMBL: ENSMUSP00000150205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061669] [ENSMUST00000215930] [ENSMUST00000216980]
Predicted Effect probably null
Transcript: ENSMUST00000061669
AA Change: M1R

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057468
Gene: ENSMUSG00000047207
AA Change: M1R

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 1.4e-52 PFAM
Pfam:7tm_1 45 295 1.7e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215930
AA Change: M1R

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably null
Transcript: ENSMUST00000216980
AA Change: M1R

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tll1 T C 8: 64,098,234 probably null Het
Tmem135 A T 7: 89,156,510 probably null Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Olfr1495
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Olfr1495 APN 19 13768537 missense probably damaging 1.00
IGL01869:Olfr1495 APN 19 13769170 missense probably benign 0.02
IGL02088:Olfr1495 APN 19 13768666 missense probably damaging 1.00
R1583:Olfr1495 UTSW 19 13768510 missense probably benign 0.10
R1713:Olfr1495 UTSW 19 13769295 missense probably benign 0.00
R1859:Olfr1495 UTSW 19 13768724 nonsense probably null
R3717:Olfr1495 UTSW 19 13769064 missense probably damaging 0.98
R3718:Olfr1495 UTSW 19 13769064 missense probably damaging 0.98
R3881:Olfr1495 UTSW 19 13768780 missense probably benign
R4370:Olfr1495 UTSW 19 13768951 missense probably benign 0.02
R4873:Olfr1495 UTSW 19 13768762 missense probably damaging 0.99
R4875:Olfr1495 UTSW 19 13768762 missense probably damaging 0.99
R6335:Olfr1495 UTSW 19 13768780 missense probably benign
R6352:Olfr1495 UTSW 19 13768464 missense probably benign
R7038:Olfr1495 UTSW 19 13768351 missense probably benign
R7107:Olfr1495 UTSW 19 13769161 missense probably benign 0.22
R7504:Olfr1495 UTSW 19 13768732 missense probably damaging 1.00
R7812:Olfr1495 UTSW 19 13769016 missense probably benign 0.05
R7852:Olfr1495 UTSW 19 13768510 missense probably benign 0.00
R7860:Olfr1495 UTSW 19 13768352 missense probably benign 0.09
R8183:Olfr1495 UTSW 19 13768722 missense probably damaging 0.99
R8357:Olfr1495 UTSW 19 13768357 missense probably benign 0.09
R8457:Olfr1495 UTSW 19 13768357 missense probably benign 0.09
R8716:Olfr1495 UTSW 19 13768821 missense not run
Z1088:Olfr1495 UTSW 19 13768416 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CCCAATTAATGAAGGCGTCCAG -3'
(R):5'- TTTCCACAAATGACAGACTGCC -3'

Sequencing Primer
(F):5'- GGCGTCCAGAGAAAACCATGC -3'
(R):5'- CTGCCCAGGAAGAAGTACATG -3'
Posted On2019-10-24