Incidental Mutation 'R7627:Gls'
ID589479
Institutional Source Beutler Lab
Gene Symbol Gls
Ensembl Gene ENSMUSG00000026103
Gene Nameglutaminase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7627 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location52163448-52233232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52166266 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 639 (D639E)
Ref Sequence ENSEMBL: ENSMUSP00000110158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070968] [ENSMUST00000114512] [ENSMUST00000114513] [ENSMUST00000189244]
Predicted Effect probably benign
Transcript: ENSMUST00000070968
SMART Domains Protein: ENSMUSP00000066743
Gene: ENSMUSG00000026104

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 139 315 1.4e-56 PFAM
Pfam:STAT_bind 317 566 4.2e-82 PFAM
SH2 571 687 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 715 739 2.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114512
AA Change: D456E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110157
Gene: ENSMUSG00000026103
AA Change: D456E

DomainStartEndE-ValueType
Pfam:Glutaminase 66 352 1.7e-125 PFAM
ANK 407 437 3.9e-6 SMART
ANK 441 470 3.6e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114513
AA Change: D639E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110158
Gene: ENSMUSG00000026103
AA Change: D639E

DomainStartEndE-ValueType
low complexity region 56 77 N/A INTRINSIC
low complexity region 89 110 N/A INTRINSIC
Pfam:Glutaminase 249 535 4.2e-123 PFAM
ANK 590 620 6.02e-4 SMART
ANK 624 653 5.69e2 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116901
Gene: ENSMUSG00000026103
AA Change: D169E

DomainStartEndE-ValueType
Pfam:Glutaminase 5 66 3.1e-26 PFAM
ANK 121 151 6.02e-4 SMART
ANK 155 184 5.69e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189244
SMART Domains Protein: ENSMUSP00000140482
Gene: ENSMUSG00000026104

DomainStartEndE-ValueType
Pfam:STAT_bind 13 61 2.6e-14 PFAM
SH2 65 181 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 209 233 7.8e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the K-type mitochondrial glutaminase. The encoded protein is an phosphate-activated amidohydrolase that catalyzes the hydrolysis of glutamine to glutamate and ammonia. This protein is primarily expressed in the brain and kidney plays an essential role in generating energy for metabolism, synthesizing the brain neurotransmitter glutamate and maintaining acid-base balance in the kidney. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for targeted null mutations die within 1 day postnatally with abnormal respiratory function and goal-oriented behavior toward dam. Mice homozygous for another allele exhibit abnormal TNFA-stimulated astrocyte extracellular vesicle release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T A 14: 34,512,098 I79L unknown Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Acvrl1 G A 15: 101,135,866 R143Q probably benign Het
Adam22 A G 5: 8,367,933 S8P probably benign Het
Ankrd11 A G 8: 122,890,951 I2054T possibly damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Cad T A 5: 31,060,164 L354Q probably damaging Het
Ccdc15 A T 9: 37,342,402 C184S unknown Het
Ccl8 A G 11: 82,116,039 D26G probably benign Het
Ccsap T C 8: 123,842,358 Y248C probably damaging Het
Col5a1 T G 2: 27,950,653 Y271* probably null Het
Dnmt3b A G 2: 153,677,580 N695S probably benign Het
Dync1li2 A G 8: 104,429,508 C234R probably benign Het
Dync2h1 A T 9: 7,101,111 D2758E probably benign Het
Eif2ak3 A T 6: 70,892,935 T869S probably benign Het
Foxn4 G T 5: 114,260,434 P175H possibly damaging Het
Gbp5 T G 3: 142,500,558 M1R probably null Het
Glp2r G T 11: 67,746,763 L30I unknown Het
Gm5145 G T 17: 20,570,392 E11* probably null Het
Gm5724 C T 6: 141,744,545 V161I probably damaging Het
Gm9772 T A 17: 22,007,179 K41N probably damaging Het
Gnat3 A T 5: 17,999,748 D133V Het
Gse1 C A 8: 120,572,777 P849T unknown Het
Hist1h2ak C A 13: 21,753,746 V28L probably benign Het
Hoxb9 A G 11: 96,274,695 T197A probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Leng9 A G 7: 4,148,618 L353P probably damaging Het
Mamdc2 A T 19: 23,310,991 M561K probably damaging Het
Mamdc4 A G 2: 25,568,213 V395A probably damaging Het
Mrpl32 G A 13: 14,612,913 R36C probably benign Het
Olfr1415 A T 1: 92,491,385 Y123* probably null Het
Olfr859 A G 9: 19,808,651 D111G probably damaging Het
Papss1 T A 3: 131,585,112 D205E probably benign Het
Pdlim2 T C 14: 70,171,475 D151G probably benign Het
Pdxp T C 15: 78,914,139 V57A probably damaging Het
Plec T A 15: 76,177,394 E2781V probably damaging Het
Prr7 GCGCCGCCGCACGCGCACCCGCACCCACACCATCACGCACTGCCGCACCCACCGCCGCCGCAC GCGCCGCCGCAC 13: 55,472,334 probably benign Het
Rnf32 G A 5: 29,197,950 probably benign Het
Ryr2 A G 13: 11,761,327 V1108A possibly damaging Het
Slc4a8 A G 15: 100,788,223 H276R probably benign Het
Spta1 T A 1: 174,205,378 D1000E probably damaging Het
Sva C A 6: 42,042,664 Q153K unknown Het
Tmprss11d T C 5: 86,309,506 Y236C possibly damaging Het
Zfp160 T C 17: 21,027,008 S607P probably damaging Het
Zfp82 C A 7: 30,056,722 G312W probably damaging Het
Other mutations in Gls
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Gls APN 1 52188708 missense probably damaging 1.00
IGL01366:Gls APN 1 52168399 missense probably damaging 1.00
IGL01367:Gls APN 1 52168399 missense probably damaging 1.00
IGL01832:Gls APN 1 52168409 splice site probably null
IGL02045:Gls APN 1 52219515 missense probably benign 0.01
LCD18:Gls UTSW 1 52183367 intron probably benign
R0268:Gls UTSW 1 52232694 small deletion probably benign
R0373:Gls UTSW 1 52188699 missense probably damaging 1.00
R0590:Gls UTSW 1 52212375 unclassified probably benign
R1440:Gls UTSW 1 52191134 missense possibly damaging 0.59
R1628:Gls UTSW 1 52232676 missense probably benign 0.06
R3684:Gls UTSW 1 52166293 missense probably damaging 1.00
R3697:Gls UTSW 1 52199764 missense possibly damaging 0.65
R3778:Gls UTSW 1 52168912 missense probably benign 0.05
R3824:Gls UTSW 1 52232988 missense possibly damaging 0.83
R4062:Gls UTSW 1 52196748 missense probably damaging 1.00
R4441:Gls UTSW 1 52196163 critical splice donor site probably null
R4740:Gls UTSW 1 52232788 missense probably damaging 0.99
R4816:Gls UTSW 1 52199945 intron probably benign
R5281:Gls UTSW 1 52191157 missense probably damaging 1.00
R5712:Gls UTSW 1 52196752 missense probably damaging 1.00
R6163:Gls UTSW 1 52215576 missense probably benign 0.00
R6357:Gls UTSW 1 52219506 missense probably damaging 0.99
R6498:Gls UTSW 1 52220039 missense probably benign
R7187:Gls UTSW 1 52219980 missense probably damaging 1.00
R7413:Gls UTSW 1 52215576 missense probably benign 0.00
R7545:Gls UTSW 1 52191152 missense probably damaging 1.00
R7648:Gls UTSW 1 52196780 missense probably damaging 0.99
R7781:Gls UTSW 1 52212333 nonsense probably null
Z1176:Gls UTSW 1 52214488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAATGCTCTCCATAGTCATGTTC -3'
(R):5'- CTCACACCAGTGTCTGAACTC -3'

Sequencing Primer
(F):5'- AGTCATGTTCCACAATGACTAGG -3'
(R):5'- GGGAGTCTCACTTGTAATACTGC -3'
Posted On2019-10-24