Incidental Mutation 'R0055:Mybph'
ID58948
Institutional Source Beutler Lab
Gene Symbol Mybph
Ensembl Gene ENSMUSG00000042451
Gene Namemyosin binding protein H
Synonyms
MMRRC Submission 038349-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0055 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location134193448-134201232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 134193852 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 88 (V88L)
Ref Sequence ENSEMBL: ENSMUSP00000141104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038445] [ENSMUST00000082060] [ENSMUST00000153856] [ENSMUST00000156873] [ENSMUST00000191577]
Predicted Effect probably damaging
Transcript: ENSMUST00000038445
AA Change: V88L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042195
Gene: ENSMUSG00000042451
AA Change: V88L

DomainStartEndE-ValueType
low complexity region 41 66 N/A INTRINSIC
FN3 77 160 4.84e-9 SMART
IG 187 270 9.78e-7 SMART
FN3 273 355 1.1e-7 SMART
IGc2 400 467 1.38e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000082060
SMART Domains Protein: ENSMUSP00000080717
Gene: ENSMUSG00000064246

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Glyco_18 30 366 1.2e-143 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134812
Predicted Effect probably benign
Transcript: ENSMUST00000153856
SMART Domains Protein: ENSMUSP00000117117
Gene: ENSMUSG00000064246

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 358 1.2e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156873
SMART Domains Protein: ENSMUSP00000119205
Gene: ENSMUSG00000064246

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Glyco_18 20 356 1.2e-143 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191577
AA Change: V88L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141104
Gene: ENSMUSG00000042451
AA Change: V88L

DomainStartEndE-ValueType
low complexity region 41 66 N/A INTRINSIC
FN3 77 160 4.84e-9 SMART
IG 187 270 9.78e-7 SMART
FN3 273 355 1.1e-7 SMART
IGc2 400 467 1.38e-6 SMART
Meta Mutation Damage Score 0.4964 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,968,161 S108R probably damaging Het
2010300C02Rik A C 1: 37,624,256 S854A probably benign Het
2210016F16Rik T C 13: 58,384,166 D192G probably damaging Het
4921501E09Rik A T 17: 33,066,722 W369R probably damaging Het
A2ml1 T C 6: 128,570,094 probably benign Het
Atp6v1h A T 1: 5,084,454 T2S probably benign Het
Bcl11b G A 12: 107,965,777 P179S probably benign Het
Cacna1a C T 8: 84,580,058 probably benign Het
Ccdc146 C T 5: 21,297,006 probably null Het
Ccdc61 T C 7: 18,892,536 D128G probably damaging Het
Cd55 A G 1: 130,459,576 probably benign Het
Cdk7 C A 13: 100,719,304 E99* probably null Het
Cox8a A T 19: 7,217,509 S2T probably damaging Het
Dennd5a A G 7: 109,899,791 I955T possibly damaging Het
Dopey1 A C 9: 86,512,652 E602A probably benign Het
Ephx4 T C 5: 107,413,078 L32S probably damaging Het
Fbxo21 T A 5: 118,000,490 D493E probably benign Het
Frmd4b A T 6: 97,323,649 probably benign Het
Fzd1 A T 5: 4,756,037 M515K possibly damaging Het
Gli2 A G 1: 118,890,408 probably benign Het
Gm12887 T A 4: 121,616,469 K61N probably damaging Het
Grin2a A T 16: 9,669,807 V409D probably damaging Het
Grin2b T C 6: 135,923,203 I227V probably benign Het
Helz2 T G 2: 181,228,821 D2879A possibly damaging Het
Itpr2 T C 6: 146,323,133 N1453S probably benign Het
Itpr3 C A 17: 27,098,322 S817Y probably damaging Het
Lin7c T A 2: 109,896,453 probably benign Het
Ly75 T C 2: 60,321,918 E1097G probably benign Het
Mcm10 T C 2: 4,991,407 N882D probably damaging Het
Mettl13 A T 1: 162,546,181 L167Q probably damaging Het
Morn2 A T 17: 80,295,513 M1L probably benign Het
Nefm T A 14: 68,121,199 probably benign Het
Nf1 A G 11: 79,471,551 E1497G probably damaging Het
Olfr1281 T A 2: 111,328,525 Y35* probably null Het
Olfr137 T C 17: 38,304,811 S217G possibly damaging Het
Olfr615 A G 7: 103,561,037 K187E probably damaging Het
Olfr670 T A 7: 104,960,496 T79S possibly damaging Het
Plcd3 C G 11: 103,077,585 W382S probably damaging Het
Plxna1 T A 6: 89,329,739 I1370F possibly damaging Het
Rarb G A 14: 16,509,066 R106C probably damaging Het
Rps6ka5 G A 12: 100,678,580 T37I probably damaging Het
Runx1 G T 16: 92,644,141 probably benign Het
Scube1 A G 15: 83,634,736 V301A probably damaging Het
Sema3a A T 5: 13,400,037 N27I possibly damaging Het
Slc15a3 G T 19: 10,843,042 E8* probably null Het
Slc22a5 T C 11: 53,891,206 S112G probably benign Het
Slc25a45 T C 19: 5,880,467 F3L probably damaging Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slfn10-ps A G 11: 83,030,300 noncoding transcript Het
Slit2 C A 5: 48,281,726 C1077* probably null Het
Spn A G 7: 127,136,322 F82L possibly damaging Het
Tbccd1 A G 16: 22,841,905 W54R probably damaging Het
Ucp1 G T 8: 83,290,604 E8* probably null Het
Unc80 A T 1: 66,506,623 probably benign Het
Vsnl1 A T 12: 11,386,986 probably null Het
Zdhhc11 C T 13: 73,982,686 Q295* probably null Het
Zfp457 T A 13: 67,294,034 H63L probably damaging Het
Other mutations in Mybph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Mybph APN 1 134193925 missense probably benign 0.02
IGL02312:Mybph APN 1 134197450 missense probably damaging 0.99
PIT4581001:Mybph UTSW 1 134194741 missense probably benign 0.00
R0055:Mybph UTSW 1 134193852 missense probably damaging 0.99
R0346:Mybph UTSW 1 134197754 missense probably damaging 1.00
R0669:Mybph UTSW 1 134197343 splice site probably null
R0765:Mybph UTSW 1 134197496 missense possibly damaging 0.78
R1349:Mybph UTSW 1 134193615 missense probably benign 0.00
R1662:Mybph UTSW 1 134193636 missense probably benign 0.01
R1728:Mybph UTSW 1 134197480 missense probably benign 0.00
R1729:Mybph UTSW 1 134197480 missense probably benign 0.00
R1730:Mybph UTSW 1 134197480 missense probably benign 0.00
R1739:Mybph UTSW 1 134197480 missense probably benign 0.00
R1762:Mybph UTSW 1 134197480 missense probably benign 0.00
R1783:Mybph UTSW 1 134197480 missense probably benign 0.00
R1784:Mybph UTSW 1 134197480 missense probably benign 0.00
R1785:Mybph UTSW 1 134197480 missense probably benign 0.00
R1978:Mybph UTSW 1 134196996 missense probably benign 0.01
R2058:Mybph UTSW 1 134200119 missense probably damaging 1.00
R3115:Mybph UTSW 1 134194738 missense probably benign
R4841:Mybph UTSW 1 134198495 missense probably damaging 1.00
R4842:Mybph UTSW 1 134198495 missense probably damaging 1.00
R5208:Mybph UTSW 1 134193535 missense probably benign
R7561:Mybph UTSW 1 134193727 critical splice donor site probably null
R7787:Mybph UTSW 1 134197508 missense probably benign 0.00
R7997:Mybph UTSW 1 134194667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAAGCCTGAACCTCCGAGTGAAG -3'
(R):5'- AGCCAGGTGGTAGCAGTTAAGACC -3'

Sequencing Primer
(F):5'- ACCTCCGAGTGAAGGTGAC -3'
(R):5'- ACTCATTGCAGGGACTGTGC -3'
Posted On2013-07-11