Incidental Mutation 'R7627:Dnmt3b'
ID589484
Institutional Source Beutler Lab
Gene Symbol Dnmt3b
Ensembl Gene ENSMUSG00000027478
Gene NameDNA methyltransferase 3B
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7627 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location153649450-153687730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 153677580 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 695 (N695S)
Ref Sequence ENSEMBL: ENSMUSP00000072761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056495] [ENSMUST00000072997] [ENSMUST00000081628] [ENSMUST00000088976] [ENSMUST00000103150] [ENSMUST00000103151] [ENSMUST00000109771] [ENSMUST00000109772] [ENSMUST00000109773] [ENSMUST00000109774]
Predicted Effect probably benign
Transcript: ENSMUST00000056495
AA Change: N696S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000051830
Gene: ENSMUSG00000027478
AA Change: N696S

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 582 732 3.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072997
AA Change: N695S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000072761
Gene: ENSMUSG00000027478
AA Change: N695S

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 581 731 4.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081628
AA Change: N675S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080334
Gene: ENSMUSG00000027478
AA Change: N675S

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 1e-54 PDB
Blast:RING 463 512 7e-28 BLAST
Pfam:DNA_methylase 561 711 4.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088976
AA Change: N695S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000086370
Gene: ENSMUSG00000027478
AA Change: N695S

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 7e-55 PDB
Blast:RING 483 532 5e-28 BLAST
Pfam:DNA_methylase 581 727 2.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103150
AA Change: N675S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099439
Gene: ENSMUSG00000027478
AA Change: N675S

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 8e-55 PDB
Blast:RING 463 512 6e-28 BLAST
Pfam:DNA_methylase 561 707 4.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103151
AA Change: N675S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099440
Gene: ENSMUSG00000027478
AA Change: N675S

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 8e-55 PDB
Blast:RING 463 512 6e-28 BLAST
Pfam:DNA_methylase 561 707 4.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109771
AA Change: N696S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000105393
Gene: ENSMUSG00000027478
AA Change: N696S

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 582 732 3.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109772
AA Change: N695S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105394
Gene: ENSMUSG00000027478
AA Change: N695S

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 7e-55 PDB
Blast:RING 483 532 5e-28 BLAST
Pfam:DNA_methylase 581 727 2.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109773
AA Change: N675S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105395
Gene: ENSMUSG00000027478
AA Change: N675S

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 1e-54 PDB
Blast:RING 463 512 7e-28 BLAST
Pfam:DNA_methylase 561 711 4.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109774
AA Change: N695S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000105396
Gene: ENSMUSG00000027478
AA Change: N695S

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 581 731 4.5e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This is one of two related genes encoding de novo DNA methyltransferases, which are responsible for the establishment of DNA methylation patterns in embryos. Loss of function of this gene results in severe developmental defects and loss of viability. Mutation of the related gene in humans causes immunodeficiency-centromeric instability-facial anomalies (ICF) syndrome. There is a pseudogene for this gene located adjacent to this gene in the same region of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit growth retardation and rostral neural tube defects, and die prenatally. Mutants exhibit slight under-methylation of endogenous viral DNA and substantial demethylation of minor satellite DNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T A 14: 34,512,098 I79L unknown Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Acvrl1 G A 15: 101,135,866 R143Q probably benign Het
Adam22 A G 5: 8,367,933 S8P probably benign Het
Ankrd11 A G 8: 122,890,951 I2054T possibly damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Cad T A 5: 31,060,164 L354Q probably damaging Het
Ccdc15 A T 9: 37,342,402 C184S unknown Het
Ccl8 A G 11: 82,116,039 D26G probably benign Het
Ccsap T C 8: 123,842,358 Y248C probably damaging Het
Col5a1 T G 2: 27,950,653 Y271* probably null Het
Dync1li2 A G 8: 104,429,508 C234R probably benign Het
Dync2h1 A T 9: 7,101,111 D2758E probably benign Het
Eif2ak3 A T 6: 70,892,935 T869S probably benign Het
Foxn4 G T 5: 114,260,434 P175H possibly damaging Het
Gbp5 T G 3: 142,500,558 M1R probably null Het
Glp2r G T 11: 67,746,763 L30I unknown Het
Gls A T 1: 52,166,266 D639E probably benign Het
Gm5145 G T 17: 20,570,392 E11* probably null Het
Gm5724 C T 6: 141,744,545 V161I probably damaging Het
Gm9772 T A 17: 22,007,179 K41N probably damaging Het
Gnat3 A T 5: 17,999,748 D133V Het
Gse1 C A 8: 120,572,777 P849T unknown Het
Hist1h2ak C A 13: 21,753,746 V28L probably benign Het
Hoxb9 A G 11: 96,274,695 T197A probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Leng9 A G 7: 4,148,618 L353P probably damaging Het
Mamdc2 A T 19: 23,310,991 M561K probably damaging Het
Mamdc4 A G 2: 25,568,213 V395A probably damaging Het
Mrpl32 G A 13: 14,612,913 R36C probably benign Het
Olfr1415 A T 1: 92,491,385 Y123* probably null Het
Olfr859 A G 9: 19,808,651 D111G probably damaging Het
Papss1 T A 3: 131,585,112 D205E probably benign Het
Pdlim2 T C 14: 70,171,475 D151G probably benign Het
Pdxp T C 15: 78,914,139 V57A probably damaging Het
Plec T A 15: 76,177,394 E2781V probably damaging Het
Prr7 GCGCCGCCGCACGCGCACCCGCACCCACACCATCACGCACTGCCGCACCCACCGCCGCCGCAC GCGCCGCCGCAC 13: 55,472,334 probably benign Het
Rnf32 G A 5: 29,197,950 probably benign Het
Ryr2 A G 13: 11,761,327 V1108A possibly damaging Het
Slc4a8 A G 15: 100,788,223 H276R probably benign Het
Spta1 T A 1: 174,205,378 D1000E probably damaging Het
Sva C A 6: 42,042,664 Q153K unknown Het
Tmprss11d T C 5: 86,309,506 Y236C possibly damaging Het
Zfp160 T C 17: 21,027,008 S607P probably damaging Het
Zfp82 C A 7: 30,056,722 G312W probably damaging Het
Other mutations in Dnmt3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Dnmt3b APN 2 153672502 missense possibly damaging 0.88
IGL00931:Dnmt3b APN 2 153686250 splice site probably benign
IGL01073:Dnmt3b APN 2 153670842 splice site probably benign
IGL01138:Dnmt3b APN 2 153661441 missense probably benign 0.01
IGL01960:Dnmt3b APN 2 153676711 missense possibly damaging 0.83
IGL02884:Dnmt3b APN 2 153674377 missense probably damaging 1.00
IGL03382:Dnmt3b APN 2 153686359 missense probably damaging 1.00
PIT4151001:Dnmt3b UTSW 2 153684479 critical splice donor site probably null
R0062:Dnmt3b UTSW 2 153672272 missense probably benign 0.01
R0122:Dnmt3b UTSW 2 153676698 missense probably damaging 1.00
R0147:Dnmt3b UTSW 2 153661457 missense possibly damaging 0.68
R0178:Dnmt3b UTSW 2 153675018 missense probably benign 0.41
R0751:Dnmt3b UTSW 2 153674842 splice site probably null
R1696:Dnmt3b UTSW 2 153676710 nonsense probably null
R1795:Dnmt3b UTSW 2 153683639 missense possibly damaging 0.92
R1889:Dnmt3b UTSW 2 153676759 missense probably benign
R2898:Dnmt3b UTSW 2 153667630 missense possibly damaging 0.85
R4201:Dnmt3b UTSW 2 153670417 nonsense probably null
R4630:Dnmt3b UTSW 2 153670315 nonsense probably null
R4870:Dnmt3b UTSW 2 153670364 missense probably benign 0.01
R5648:Dnmt3b UTSW 2 153677198 missense probably damaging 1.00
R5814:Dnmt3b UTSW 2 153672497 missense probably benign 0.00
R6311:Dnmt3b UTSW 2 153674005 missense probably damaging 1.00
R6625:Dnmt3b UTSW 2 153665313 missense probably benign
R6818:Dnmt3b UTSW 2 153686284 missense probably damaging 1.00
R7258:Dnmt3b UTSW 2 153683599 splice site probably null
R7473:Dnmt3b UTSW 2 153684450 missense probably damaging 1.00
R7570:Dnmt3b UTSW 2 153676699 missense probably damaging 1.00
R7709:Dnmt3b UTSW 2 153672220 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGCCGTATTCATGACTCAGGC -3'
(R):5'- GATTAAGCCACACCCTCCTCTG -3'

Sequencing Primer
(F):5'- GTATTCATGACTCAGGCCCGGTC -3'
(R):5'- GAGCAGGAAATAATTTTCTCAGCCC -3'
Posted On2019-10-24