Incidental Mutation 'R7627:Cad'
ID589490
Institutional Source Beutler Lab
Gene Symbol Cad
Ensembl Gene ENSMUSG00000013629
Gene Namecarbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R7627 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location31054780-31078479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31060164 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 354 (L354Q)
Ref Sequence ENSEMBL: ENSMUSP00000013773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013773] [ENSMUST00000200953] [ENSMUST00000201182] [ENSMUST00000201838] [ENSMUST00000202795]
Predicted Effect probably damaging
Transcript: ENSMUST00000013773
AA Change: L354Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000013773
Gene: ENSMUSG00000013629
AA Change: L354Q

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.7e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.2e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.8e-85 PFAM
Pfam:ATP-grasp 522 690 1.5e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.2e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.8e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.4e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1924 2065 1.9e-44 PFAM
Pfam:OTCace 2071 2221 7.6e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200953
AA Change: L354Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144307
Gene: ENSMUSG00000013629
AA Change: L354Q

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:CPSase_L_D2 514 616 1.5e-34 PFAM
Pfam:Dala_Dala_lig_C 527 625 2.4e-7 PFAM
Pfam:CPSase_L_D2 614 655 4.9e-15 PFAM
CPSase_L_D3 735 858 9.7e-59 SMART
Pfam:ATP-grasp_4 981 1160 1.7e-23 PFAM
Pfam:CPSase_L_D2 984 1187 3e-28 PFAM
Pfam:Dala_Dala_lig_C 991 1179 2.3e-7 PFAM
Pfam:ATP-grasp 992 1159 2.1e-12 PFAM
MGS 1264 1365 1.35e-7 SMART
Pfam:Amidohydro_1 1399 1667 7.1e-12 PFAM
low complexity region 1757 1776 N/A INTRINSIC
low complexity region 1801 1817 N/A INTRINSIC
Pfam:OTCace_N 1861 2002 1.8e-44 PFAM
Pfam:OTCace 2008 2158 7.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201182
AA Change: L354Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144684
Gene: ENSMUSG00000013629
AA Change: L354Q

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.1e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.7e-85 PFAM
Pfam:ATP-grasp 522 690 1.4e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.1e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.7e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.1e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1949 1994 1.4e-11 PFAM
Pfam:OTCace 2000 2150 7.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201838
AA Change: L354Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144127
Gene: ENSMUSG00000013629
AA Change: L354Q

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 6.3e-48 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.9e-16 PFAM
Pfam:CPSase_L_D2 514 718 3.7e-86 PFAM
Pfam:ATP-grasp 522 690 2.5e-10 PFAM
Pfam:Dala_Dala_lig_C 526 687 4.2e-11 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
SCOP:d1a9xa3 935 964 1e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202795
AA Change: L354Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144009
Gene: ENSMUSG00000013629
AA Change: L354Q

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 1.9e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 5.9e-16 PFAM
Pfam:CPSase_L_D2 514 718 1.2e-85 PFAM
Pfam:ATP-grasp 522 690 7.3e-10 PFAM
Pfam:Dala_Dala_lig_C 527 687 1.3e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 8.9e-24 PFAM
Pfam:CPSase_L_D2 1047 1250 2.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 1.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 1.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 2.5e-11 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1970 2004 4.6e-11 PFAM
Pfam:OTCace 2010 2160 9.9e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T A 14: 34,512,098 I79L unknown Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Acvrl1 G A 15: 101,135,866 R143Q probably benign Het
Adam22 A G 5: 8,367,933 S8P probably benign Het
Ankrd11 A G 8: 122,890,951 I2054T possibly damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Ccdc15 A T 9: 37,342,402 C184S unknown Het
Ccl8 A G 11: 82,116,039 D26G probably benign Het
Ccsap T C 8: 123,842,358 Y248C probably damaging Het
Col5a1 T G 2: 27,950,653 Y271* probably null Het
Dnmt3b A G 2: 153,677,580 N695S probably benign Het
Dync1li2 A G 8: 104,429,508 C234R probably benign Het
Dync2h1 A T 9: 7,101,111 D2758E probably benign Het
Eif2ak3 A T 6: 70,892,935 T869S probably benign Het
Foxn4 G T 5: 114,260,434 P175H possibly damaging Het
Gbp5 T G 3: 142,500,558 M1R probably null Het
Glp2r G T 11: 67,746,763 L30I unknown Het
Gls A T 1: 52,166,266 D639E probably benign Het
Gm5145 G T 17: 20,570,392 E11* probably null Het
Gm5724 C T 6: 141,744,545 V161I probably damaging Het
Gm9772 T A 17: 22,007,179 K41N probably damaging Het
Gnat3 A T 5: 17,999,748 D133V Het
Gse1 C A 8: 120,572,777 P849T unknown Het
Hist1h2ak C A 13: 21,753,746 V28L probably benign Het
Hoxb9 A G 11: 96,274,695 T197A probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Leng9 A G 7: 4,148,618 L353P probably damaging Het
Mamdc2 A T 19: 23,310,991 M561K probably damaging Het
Mamdc4 A G 2: 25,568,213 V395A probably damaging Het
Mrpl32 G A 13: 14,612,913 R36C probably benign Het
Olfr1415 A T 1: 92,491,385 Y123* probably null Het
Olfr859 A G 9: 19,808,651 D111G probably damaging Het
Papss1 T A 3: 131,585,112 D205E probably benign Het
Pdlim2 T C 14: 70,171,475 D151G probably benign Het
Pdxp T C 15: 78,914,139 V57A probably damaging Het
Plec T A 15: 76,177,394 E2781V probably damaging Het
Prr7 GCGCCGCCGCACGCGCACCCGCACCCACACCATCACGCACTGCCGCACCCACCGCCGCCGCAC GCGCCGCCGCAC 13: 55,472,334 probably benign Het
Rnf32 G A 5: 29,197,950 probably benign Het
Ryr2 A G 13: 11,761,327 V1108A possibly damaging Het
Slc4a8 A G 15: 100,788,223 H276R probably benign Het
Spta1 T A 1: 174,205,378 D1000E probably damaging Het
Sva C A 6: 42,042,664 Q153K unknown Het
Tmprss11d T C 5: 86,309,506 Y236C possibly damaging Het
Zfp160 T C 17: 21,027,008 S607P probably damaging Het
Zfp82 C A 7: 30,056,722 G312W probably damaging Het
Other mutations in Cad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Cad APN 5 31061484 missense probably damaging 1.00
IGL00908:Cad APN 5 31059054 missense possibly damaging 0.93
IGL01068:Cad APN 5 31061770 splice site probably benign
IGL01638:Cad APN 5 31067614 missense probably damaging 1.00
IGL02483:Cad APN 5 31060826 critical splice acceptor site probably null
IGL02499:Cad APN 5 31069604 missense probably damaging 1.00
IGL02691:Cad APN 5 31055294 missense probably damaging 1.00
IGL03002:Cad APN 5 31054986 missense probably benign 0.00
PIT4696001:Cad UTSW 5 31072094 missense probably damaging 0.99
R0212:Cad UTSW 5 31078110 missense probably damaging 1.00
R0317:Cad UTSW 5 31072321 missense probably benign 0.01
R0335:Cad UTSW 5 31073985 unclassified probably benign
R0401:Cad UTSW 5 31073986 unclassified probably benign
R0445:Cad UTSW 5 31072709 missense probably benign 0.08
R0494:Cad UTSW 5 31077512 unclassified probably benign
R0532:Cad UTSW 5 31062187 splice site probably benign
R0539:Cad UTSW 5 31075457 splice site probably benign
R0578:Cad UTSW 5 31058776 missense probably benign 0.01
R0590:Cad UTSW 5 31062231 missense probably damaging 1.00
R0638:Cad UTSW 5 31077688 missense probably damaging 0.98
R0831:Cad UTSW 5 31067600 missense probably damaging 1.00
R1329:Cad UTSW 5 31059582 missense probably damaging 1.00
R1513:Cad UTSW 5 31068762 missense probably damaging 1.00
R1531:Cad UTSW 5 31076219 missense probably benign 0.14
R1763:Cad UTSW 5 31060951 missense probably damaging 1.00
R1785:Cad UTSW 5 31058072 missense probably damaging 1.00
R1786:Cad UTSW 5 31058072 missense probably damaging 1.00
R2131:Cad UTSW 5 31058072 missense probably damaging 1.00
R2165:Cad UTSW 5 31062220 missense probably damaging 1.00
R3103:Cad UTSW 5 31061674 missense possibly damaging 0.95
R3113:Cad UTSW 5 31074137 missense possibly damaging 0.50
R3762:Cad UTSW 5 31075546 splice site probably null
R3847:Cad UTSW 5 31061650 missense probably damaging 1.00
R3898:Cad UTSW 5 31074022 missense probably benign 0.06
R3943:Cad UTSW 5 31072385 critical splice donor site probably null
R4213:Cad UTSW 5 31072344 missense probably benign 0.01
R4458:Cad UTSW 5 31061226 missense probably damaging 1.00
R4562:Cad UTSW 5 31058133 missense possibly damaging 0.82
R4629:Cad UTSW 5 31070295 missense probably damaging 1.00
R4717:Cad UTSW 5 31066686 critical splice acceptor site probably null
R4811:Cad UTSW 5 31074690 missense probably benign 0.02
R5044:Cad UTSW 5 31055021 missense probably benign 0.00
R5630:Cad UTSW 5 31060573 missense probably damaging 1.00
R5660:Cad UTSW 5 31076847 missense probably damaging 1.00
R6008:Cad UTSW 5 31069112 missense probably damaging 1.00
R6029:Cad UTSW 5 31054983 missense possibly damaging 0.65
R6073:Cad UTSW 5 31062562 missense possibly damaging 0.84
R6240:Cad UTSW 5 31072978 missense probably benign 0.00
R6260:Cad UTSW 5 31066800 missense probably null
R7145:Cad UTSW 5 31067612 missense possibly damaging 0.89
R7303:Cad UTSW 5 31060213 critical splice donor site probably null
R7352:Cad UTSW 5 31058078 missense probably damaging 1.00
R7382:Cad UTSW 5 31075829 missense probably benign
R7387:Cad UTSW 5 31061940 missense probably damaging 1.00
R7455:Cad UTSW 5 31074162 missense probably damaging 0.99
R7596:Cad UTSW 5 31069048 missense probably benign
R7898:Cad UTSW 5 31061485 missense probably damaging 1.00
R8022:Cad UTSW 5 31068806 missense probably damaging 1.00
R8115:Cad UTSW 5 31060927 missense possibly damaging 0.82
R8511:Cad UTSW 5 31075821 missense probably benign 0.00
RF001:Cad UTSW 5 31060212 critical splice donor site probably benign
RF012:Cad UTSW 5 31060212 critical splice donor site probably benign
X0021:Cad UTSW 5 31068131 missense probably null 1.00
X0022:Cad UTSW 5 31072317 missense probably damaging 0.99
Z1177:Cad UTSW 5 31068421 missense probably damaging 1.00
Z1177:Cad UTSW 5 31075128 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CTGTTCCAATGAAGGCATAGTGC -3'
(R):5'- TCCAGAGCCCCTAACTCTAGAG -3'

Sequencing Primer
(F):5'- ATAGTGCACGACAGCCTG -3'
(R):5'- GAGTTCCTTTACACAGAAATGGCAC -3'
Posted On2019-10-24