Incidental Mutation 'R7627:Foxn4'
ID589492
Institutional Source Beutler Lab
Gene Symbol Foxn4
Ensembl Gene ENSMUSG00000042002
Gene Nameforkhead box N4
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7627 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location114254164-114273807 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 114260434 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 175 (P175H)
Ref Sequence ENSEMBL: ENSMUSP00000047951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044790] [ENSMUST00000129530] [ENSMUST00000144050]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044790
AA Change: P175H

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047951
Gene: ENSMUSG00000042002
AA Change: P175H

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
FH 195 287 2.15e-46 SMART
low complexity region 386 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129530
Predicted Effect possibly damaging
Transcript: ENSMUST00000144050
AA Change: P116H

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the winged-helix/forkhead family of transcription factors, such as FOXN4, are characterized by a 110-amino acid DNA-binding domain that can fold into a variant of the helix-turn-helix motif consisting of 3 alpha helices flanked by 2 large loops or wings. These transcription factors are involved in a variety of biologic processes as key regulators in development and metabolism (Li et al., 2004 [PubMed 15363391]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality and abnormal retina morphology with a total loss of horizontal cells and decreased amacrine cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T A 14: 34,512,098 I79L unknown Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Acvrl1 G A 15: 101,135,866 R143Q probably benign Het
Adam22 A G 5: 8,367,933 S8P probably benign Het
Ankrd11 A G 8: 122,890,951 I2054T possibly damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Cad T A 5: 31,060,164 L354Q probably damaging Het
Ccdc15 A T 9: 37,342,402 C184S unknown Het
Ccl8 A G 11: 82,116,039 D26G probably benign Het
Ccsap T C 8: 123,842,358 Y248C probably damaging Het
Col5a1 T G 2: 27,950,653 Y271* probably null Het
Dnmt3b A G 2: 153,677,580 N695S probably benign Het
Dync1li2 A G 8: 104,429,508 C234R probably benign Het
Dync2h1 A T 9: 7,101,111 D2758E probably benign Het
Eif2ak3 A T 6: 70,892,935 T869S probably benign Het
Gbp5 T G 3: 142,500,558 M1R probably null Het
Glp2r G T 11: 67,746,763 L30I unknown Het
Gls A T 1: 52,166,266 D639E probably benign Het
Gm5145 G T 17: 20,570,392 E11* probably null Het
Gm5724 C T 6: 141,744,545 V161I probably damaging Het
Gm9772 T A 17: 22,007,179 K41N probably damaging Het
Gnat3 A T 5: 17,999,748 D133V Het
Gse1 C A 8: 120,572,777 P849T unknown Het
Hist1h2ak C A 13: 21,753,746 V28L probably benign Het
Hoxb9 A G 11: 96,274,695 T197A probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Leng9 A G 7: 4,148,618 L353P probably damaging Het
Mamdc2 A T 19: 23,310,991 M561K probably damaging Het
Mamdc4 A G 2: 25,568,213 V395A probably damaging Het
Mrpl32 G A 13: 14,612,913 R36C probably benign Het
Olfr1415 A T 1: 92,491,385 Y123* probably null Het
Olfr859 A G 9: 19,808,651 D111G probably damaging Het
Papss1 T A 3: 131,585,112 D205E probably benign Het
Pdlim2 T C 14: 70,171,475 D151G probably benign Het
Pdxp T C 15: 78,914,139 V57A probably damaging Het
Plec T A 15: 76,177,394 E2781V probably damaging Het
Prr7 GCGCCGCCGCACGCGCACCCGCACCCACACCATCACGCACTGCCGCACCCACCGCCGCCGCAC GCGCCGCCGCAC 13: 55,472,334 probably benign Het
Rnf32 G A 5: 29,197,950 probably benign Het
Ryr2 A G 13: 11,761,327 V1108A possibly damaging Het
Slc4a8 A G 15: 100,788,223 H276R probably benign Het
Spta1 T A 1: 174,205,378 D1000E probably damaging Het
Sva C A 6: 42,042,664 Q153K unknown Het
Tmprss11d T C 5: 86,309,506 Y236C possibly damaging Het
Zfp160 T C 17: 21,027,008 S607P probably damaging Het
Zfp82 C A 7: 30,056,722 G312W probably damaging Het
Other mutations in Foxn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02990:Foxn4 APN 5 114272989 missense probably damaging 0.98
R0001:Foxn4 UTSW 5 114260870 missense probably damaging 1.00
R0194:Foxn4 UTSW 5 114259748 critical splice donor site probably null
R0555:Foxn4 UTSW 5 114263114 missense probably damaging 1.00
R0617:Foxn4 UTSW 5 114261068 splice site probably benign
R1662:Foxn4 UTSW 5 114256894 missense probably benign
R1785:Foxn4 UTSW 5 114263132 missense probably damaging 0.99
R1786:Foxn4 UTSW 5 114263132 missense probably damaging 0.99
R2266:Foxn4 UTSW 5 114255601 missense probably damaging 0.99
R2267:Foxn4 UTSW 5 114255601 missense probably damaging 0.99
R2268:Foxn4 UTSW 5 114255601 missense probably damaging 0.99
R2269:Foxn4 UTSW 5 114255601 missense probably damaging 0.99
R2397:Foxn4 UTSW 5 114255495 missense probably damaging 1.00
R3121:Foxn4 UTSW 5 114258715 missense probably damaging 0.99
R3122:Foxn4 UTSW 5 114258715 missense probably damaging 0.99
R4579:Foxn4 UTSW 5 114256825 missense possibly damaging 0.65
R4623:Foxn4 UTSW 5 114260930 missense possibly damaging 0.64
R4749:Foxn4 UTSW 5 114255567 missense probably damaging 1.00
R5083:Foxn4 UTSW 5 114256927 missense probably damaging 1.00
R5100:Foxn4 UTSW 5 114256759 missense possibly damaging 0.87
R5661:Foxn4 UTSW 5 114272992 missense probably benign
R7015:Foxn4 UTSW 5 114256855 missense possibly damaging 0.95
R7292:Foxn4 UTSW 5 114258655 nonsense probably null
R7342:Foxn4 UTSW 5 114258699 missense probably damaging 1.00
R7695:Foxn4 UTSW 5 114256587 missense probably damaging 1.00
R7970:Foxn4 UTSW 5 114263007 critical splice donor site probably null
R8037:Foxn4 UTSW 5 114256597 missense probably damaging 1.00
R8038:Foxn4 UTSW 5 114256597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGATACAAAGTTGCCAGTCCC -3'
(R):5'- CTAATATACCACTCAGGCTCCTGG -3'

Sequencing Primer
(F):5'- GATCCTACCTGGGGACAACTC -3'
(R):5'- GGGACAAGATGCCCTCTTTG -3'
Posted On2019-10-24