Incidental Mutation 'R7627:Leng9'
ID589496
Institutional Source Beutler Lab
Gene Symbol Leng9
Ensembl Gene ENSMUSG00000043432
Gene Nameleukocyte receptor cluster (LRC) member 9
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7627 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4147915-4150374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4148618 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 353 (L353P)
Ref Sequence ENSEMBL: ENSMUSP00000061079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037472] [ENSMUST00000058358] [ENSMUST00000076831] [ENSMUST00000121270] [ENSMUST00000140410] [ENSMUST00000143825]
Predicted Effect probably benign
Transcript: ENSMUST00000037472
SMART Domains Protein: ENSMUSP00000046465
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
Pfam:SAC3_GANP 567 762 8.2e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000058358
AA Change: L353P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061079
Gene: ENSMUSG00000043432
AA Change: L353P

DomainStartEndE-ValueType
ZnF_C3H1 8 34 1.72e-4 SMART
Pfam:DUF504 77 128 1.9e-11 PFAM
Pfam:AKAP7_NLS 305 484 2.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076831
SMART Domains Protein: ENSMUSP00000092508
Gene: ENSMUSG00000063838

DomainStartEndE-ValueType
PBD 23 57 5.86e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121270
SMART Domains Protein: ENSMUSP00000112428
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
Pfam:SAC3_GANP 567 764 7.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140410
Predicted Effect probably benign
Transcript: ENSMUST00000143825
SMART Domains Protein: ENSMUSP00000117257
Gene: ENSMUSG00000063838

DomainStartEndE-ValueType
PBD 23 57 5.86e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T A 14: 34,512,098 I79L unknown Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Acvrl1 G A 15: 101,135,866 R143Q probably benign Het
Adam22 A G 5: 8,367,933 S8P probably benign Het
Ankrd11 A G 8: 122,890,951 I2054T possibly damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Cad T A 5: 31,060,164 L354Q probably damaging Het
Ccdc15 A T 9: 37,342,402 C184S unknown Het
Ccl8 A G 11: 82,116,039 D26G probably benign Het
Ccsap T C 8: 123,842,358 Y248C probably damaging Het
Col5a1 T G 2: 27,950,653 Y271* probably null Het
Dnmt3b A G 2: 153,677,580 N695S probably benign Het
Dync1li2 A G 8: 104,429,508 C234R probably benign Het
Dync2h1 A T 9: 7,101,111 D2758E probably benign Het
Eif2ak3 A T 6: 70,892,935 T869S probably benign Het
Foxn4 G T 5: 114,260,434 P175H possibly damaging Het
Gbp5 T G 3: 142,500,558 M1R probably null Het
Glp2r G T 11: 67,746,763 L30I unknown Het
Gls A T 1: 52,166,266 D639E probably benign Het
Gm5145 G T 17: 20,570,392 E11* probably null Het
Gm5724 C T 6: 141,744,545 V161I probably damaging Het
Gm9772 T A 17: 22,007,179 K41N probably damaging Het
Gnat3 A T 5: 17,999,748 D133V Het
Gse1 C A 8: 120,572,777 P849T unknown Het
Hist1h2ak C A 13: 21,753,746 V28L probably benign Het
Hoxb9 A G 11: 96,274,695 T197A probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Mamdc2 A T 19: 23,310,991 M561K probably damaging Het
Mamdc4 A G 2: 25,568,213 V395A probably damaging Het
Mrpl32 G A 13: 14,612,913 R36C probably benign Het
Olfr1415 A T 1: 92,491,385 Y123* probably null Het
Olfr859 A G 9: 19,808,651 D111G probably damaging Het
Papss1 T A 3: 131,585,112 D205E probably benign Het
Pdlim2 T C 14: 70,171,475 D151G probably benign Het
Pdxp T C 15: 78,914,139 V57A probably damaging Het
Plec T A 15: 76,177,394 E2781V probably damaging Het
Prr7 GCGCCGCCGCACGCGCACCCGCACCCACACCATCACGCACTGCCGCACCCACCGCCGCCGCAC GCGCCGCCGCAC 13: 55,472,334 probably benign Het
Rnf32 G A 5: 29,197,950 probably benign Het
Ryr2 A G 13: 11,761,327 V1108A possibly damaging Het
Slc4a8 A G 15: 100,788,223 H276R probably benign Het
Spta1 T A 1: 174,205,378 D1000E probably damaging Het
Sva C A 6: 42,042,664 Q153K unknown Het
Tmprss11d T C 5: 86,309,506 Y236C possibly damaging Het
Zfp160 T C 17: 21,027,008 S607P probably damaging Het
Zfp82 C A 7: 30,056,722 G312W probably damaging Het
Other mutations in Leng9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01903:Leng9 APN 7 4148747 missense probably damaging 1.00
IGL01970:Leng9 APN 7 4148327 missense probably damaging 0.99
IGL02197:Leng9 APN 7 4148724 missense probably damaging 1.00
IGL03013:Leng9 APN 7 4148738 missense probably damaging 1.00
R1616:Leng9 UTSW 7 4148903 missense probably benign 0.00
R2352:Leng9 UTSW 7 4149410 missense probably damaging 1.00
R2419:Leng9 UTSW 7 4148627 missense probably benign 0.32
R4156:Leng9 UTSW 7 4149434 missense possibly damaging 0.70
R4832:Leng9 UTSW 7 4149030 missense probably damaging 0.99
R4841:Leng9 UTSW 7 4149386 missense probably damaging 1.00
R4842:Leng9 UTSW 7 4149386 missense probably damaging 1.00
R7468:Leng9 UTSW 7 4148801 missense probably benign
R7679:Leng9 UTSW 7 4149660 missense probably benign 0.11
X0058:Leng9 UTSW 7 4149383 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TTTGGGCCATACCTGTCAGTG -3'
(R):5'- AAAGGGCTTTCTGCTGAAGAG -3'

Sequencing Primer
(F):5'- CCATACCTGTCAGTGTGGGG -3'
(R):5'- TGTTTGGCCTGACGACAGAAG -3'
Posted On2019-10-24