Incidental Mutation 'R7627:Zfp82'
ID589497
Institutional Source Beutler Lab
Gene Symbol Zfp82
Ensembl Gene ENSMUSG00000098022
Gene Namezinc finger protein 82
SynonymsKRAB16
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R7627 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location30054489-30072900 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30056722 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 312 (G312W)
Ref Sequence ENSEMBL: ENSMUSP00000138217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080834] [ENSMUST00000182546] [ENSMUST00000182746] [ENSMUST00000182919] [ENSMUST00000183115] [ENSMUST00000183190]
Predicted Effect probably damaging
Transcript: ENSMUST00000080834
AA Change: G342W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079647
Gene: ENSMUSG00000098022
AA Change: G342W

DomainStartEndE-ValueType
KRAB 6 66 8.68e-33 SMART
ZnF_C2H2 168 190 1.1e-2 SMART
ZnF_C2H2 196 218 1.69e-3 SMART
ZnF_C2H2 224 246 1.79e-2 SMART
ZnF_C2H2 252 274 4.24e-4 SMART
ZnF_C2H2 280 300 5.2e0 SMART
ZnF_C2H2 308 330 7.05e-1 SMART
ZnF_C2H2 336 358 1.2e-3 SMART
ZnF_C2H2 364 386 3.63e-3 SMART
ZnF_C2H2 392 414 4.47e-3 SMART
ZnF_C2H2 420 442 1.79e-2 SMART
ZnF_C2H2 448 470 5.5e-3 SMART
ZnF_C2H2 476 498 5.9e-3 SMART
ZnF_C2H2 504 526 1.92e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182546
AA Change: G312W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138217
Gene: ENSMUSG00000098022
AA Change: G312W

DomainStartEndE-ValueType
KRAB 6 62 5.01e-15 SMART
ZnF_C2H2 138 160 1.1e-2 SMART
ZnF_C2H2 166 188 1.69e-3 SMART
ZnF_C2H2 194 216 1.79e-2 SMART
ZnF_C2H2 222 244 4.24e-4 SMART
ZnF_C2H2 250 270 5.2e0 SMART
ZnF_C2H2 278 300 7.05e-1 SMART
ZnF_C2H2 306 328 1.2e-3 SMART
ZnF_C2H2 334 356 3.63e-3 SMART
ZnF_C2H2 362 384 4.47e-3 SMART
ZnF_C2H2 390 412 1.79e-2 SMART
ZnF_C2H2 418 440 5.5e-3 SMART
ZnF_C2H2 446 468 5.9e-3 SMART
ZnF_C2H2 474 496 1.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182746
SMART Domains Protein: ENSMUSP00000138567
Gene: ENSMUSG00000058447

DomainStartEndE-ValueType
KRAB 6 56 1.44e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182919
Predicted Effect probably benign
Transcript: ENSMUST00000183115
Predicted Effect probably benign
Transcript: ENSMUST00000183190
SMART Domains Protein: ENSMUSP00000138469
Gene: ENSMUSG00000098022

DomainStartEndE-ValueType
KRAB 6 66 8.68e-33 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T A 14: 34,512,098 I79L unknown Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Acvrl1 G A 15: 101,135,866 R143Q probably benign Het
Adam22 A G 5: 8,367,933 S8P probably benign Het
Ankrd11 A G 8: 122,890,951 I2054T possibly damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Cad T A 5: 31,060,164 L354Q probably damaging Het
Ccdc15 A T 9: 37,342,402 C184S unknown Het
Ccl8 A G 11: 82,116,039 D26G probably benign Het
Ccsap T C 8: 123,842,358 Y248C probably damaging Het
Col5a1 T G 2: 27,950,653 Y271* probably null Het
Dnmt3b A G 2: 153,677,580 N695S probably benign Het
Dync1li2 A G 8: 104,429,508 C234R probably benign Het
Dync2h1 A T 9: 7,101,111 D2758E probably benign Het
Eif2ak3 A T 6: 70,892,935 T869S probably benign Het
Foxn4 G T 5: 114,260,434 P175H possibly damaging Het
Gbp5 T G 3: 142,500,558 M1R probably null Het
Glp2r G T 11: 67,746,763 L30I unknown Het
Gls A T 1: 52,166,266 D639E probably benign Het
Gm5145 G T 17: 20,570,392 E11* probably null Het
Gm5724 C T 6: 141,744,545 V161I probably damaging Het
Gm9772 T A 17: 22,007,179 K41N probably damaging Het
Gnat3 A T 5: 17,999,748 D133V Het
Gse1 C A 8: 120,572,777 P849T unknown Het
Hist1h2ak C A 13: 21,753,746 V28L probably benign Het
Hoxb9 A G 11: 96,274,695 T197A probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Leng9 A G 7: 4,148,618 L353P probably damaging Het
Mamdc2 A T 19: 23,310,991 M561K probably damaging Het
Mamdc4 A G 2: 25,568,213 V395A probably damaging Het
Mrpl32 G A 13: 14,612,913 R36C probably benign Het
Olfr1415 A T 1: 92,491,385 Y123* probably null Het
Olfr859 A G 9: 19,808,651 D111G probably damaging Het
Papss1 T A 3: 131,585,112 D205E probably benign Het
Pdlim2 T C 14: 70,171,475 D151G probably benign Het
Pdxp T C 15: 78,914,139 V57A probably damaging Het
Plec T A 15: 76,177,394 E2781V probably damaging Het
Prr7 GCGCCGCCGCACGCGCACCCGCACCCACACCATCACGCACTGCCGCACCCACCGCCGCCGCAC GCGCCGCCGCAC 13: 55,472,334 probably benign Het
Rnf32 G A 5: 29,197,950 probably benign Het
Ryr2 A G 13: 11,761,327 V1108A possibly damaging Het
Slc4a8 A G 15: 100,788,223 H276R probably benign Het
Spta1 T A 1: 174,205,378 D1000E probably damaging Het
Sva C A 6: 42,042,664 Q153K unknown Het
Tmprss11d T C 5: 86,309,506 Y236C possibly damaging Het
Zfp160 T C 17: 21,027,008 S607P probably damaging Het
Other mutations in Zfp82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Zfp82 APN 7 30066330 missense probably damaging 1.00
IGL03030:Zfp82 APN 7 30057465 missense probably benign 0.00
PIT4142001:Zfp82 UTSW 7 30057276 missense probably damaging 1.00
R0432:Zfp82 UTSW 7 30056329 missense probably damaging 1.00
R0513:Zfp82 UTSW 7 30056840 missense probably damaging 1.00
R0659:Zfp82 UTSW 7 30056329 missense probably damaging 1.00
R0959:Zfp82 UTSW 7 30056451 missense probably damaging 1.00
R1510:Zfp82 UTSW 7 30056622 missense probably damaging 1.00
R1697:Zfp82 UTSW 7 30057354 missense probably benign
R2198:Zfp82 UTSW 7 30057511 missense probably benign
R2892:Zfp82 UTSW 7 30056439 missense probably damaging 1.00
R4274:Zfp82 UTSW 7 30056367 missense probably damaging 0.99
R4932:Zfp82 UTSW 7 30056887 splice site probably null
R5377:Zfp82 UTSW 7 30057166 missense probably damaging 1.00
R5677:Zfp82 UTSW 7 30057124 missense probably benign 0.43
R6822:Zfp82 UTSW 7 30056287 missense probably damaging 1.00
R7146:Zfp82 UTSW 7 30056167 missense probably benign
R7163:Zfp82 UTSW 7 30062244 missense probably benign
R7450:Zfp82 UTSW 7 30056895 missense probably damaging 1.00
R7476:Zfp82 UTSW 7 30056172 missense possibly damaging 0.69
R7631:Zfp82 UTSW 7 30056426 missense probably damaging 1.00
R8025:Zfp82 UTSW 7 30056853 missense probably damaging 1.00
R8406:Zfp82 UTSW 7 30062227 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGAGCTGAGAGAGGAGTCT -3'
(R):5'- ATACGGCCCCGAGCTCAG -3'

Sequencing Primer
(F):5'- ACCCCAATATGGATGCTCTGATG -3'
(R):5'- TCTCCATCAGAGGATCCATACTGGG -3'
Posted On2019-10-24