Incidental Mutation 'R7627:Olfr859'
ID589503
Institutional Source Beutler Lab
Gene Symbol Olfr859
Ensembl Gene ENSMUSG00000095448
Gene Nameolfactory receptor 859
SynonymsMOR146-3, GA_x6K02T2PVTD-13548326-13549255, MOR146-10_p
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R7627 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location19804906-19817626 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19808651 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 111 (D111G)
Ref Sequence ENSEMBL: ENSMUSP00000148298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086480] [ENSMUST00000212540] [ENSMUST00000217280]
Predicted Effect probably damaging
Transcript: ENSMUST00000086480
AA Change: D111G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083669
Gene: ENSMUSG00000095448
AA Change: D111G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.2e-54 PFAM
Pfam:7TM_GPCR_Srsx 35 304 2e-7 PFAM
Pfam:7tm_1 41 290 3.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212540
AA Change: D111G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217280
AA Change: D111G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T A 14: 34,512,098 I79L unknown Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Acvrl1 G A 15: 101,135,866 R143Q probably benign Het
Adam22 A G 5: 8,367,933 S8P probably benign Het
Ankrd11 A G 8: 122,890,951 I2054T possibly damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Cad T A 5: 31,060,164 L354Q probably damaging Het
Ccdc15 A T 9: 37,342,402 C184S unknown Het
Ccl8 A G 11: 82,116,039 D26G probably benign Het
Ccsap T C 8: 123,842,358 Y248C probably damaging Het
Col5a1 T G 2: 27,950,653 Y271* probably null Het
Dnmt3b A G 2: 153,677,580 N695S probably benign Het
Dync1li2 A G 8: 104,429,508 C234R probably benign Het
Dync2h1 A T 9: 7,101,111 D2758E probably benign Het
Eif2ak3 A T 6: 70,892,935 T869S probably benign Het
Foxn4 G T 5: 114,260,434 P175H possibly damaging Het
Gbp5 T G 3: 142,500,558 M1R probably null Het
Glp2r G T 11: 67,746,763 L30I unknown Het
Gls A T 1: 52,166,266 D639E probably benign Het
Gm5145 G T 17: 20,570,392 E11* probably null Het
Gm5724 C T 6: 141,744,545 V161I probably damaging Het
Gm9772 T A 17: 22,007,179 K41N probably damaging Het
Gnat3 A T 5: 17,999,748 D133V Het
Gse1 C A 8: 120,572,777 P849T unknown Het
Hist1h2ak C A 13: 21,753,746 V28L probably benign Het
Hoxb9 A G 11: 96,274,695 T197A probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Leng9 A G 7: 4,148,618 L353P probably damaging Het
Mamdc2 A T 19: 23,310,991 M561K probably damaging Het
Mamdc4 A G 2: 25,568,213 V395A probably damaging Het
Mrpl32 G A 13: 14,612,913 R36C probably benign Het
Olfr1415 A T 1: 92,491,385 Y123* probably null Het
Papss1 T A 3: 131,585,112 D205E probably benign Het
Pdlim2 T C 14: 70,171,475 D151G probably benign Het
Pdxp T C 15: 78,914,139 V57A probably damaging Het
Plec T A 15: 76,177,394 E2781V probably damaging Het
Prr7 GCGCCGCCGCACGCGCACCCGCACCCACACCATCACGCACTGCCGCACCCACCGCCGCCGCAC GCGCCGCCGCAC 13: 55,472,334 probably benign Het
Rnf32 G A 5: 29,197,950 probably benign Het
Ryr2 A G 13: 11,761,327 V1108A possibly damaging Het
Slc4a8 A G 15: 100,788,223 H276R probably benign Het
Spta1 T A 1: 174,205,378 D1000E probably damaging Het
Sva C A 6: 42,042,664 Q153K unknown Het
Tmprss11d T C 5: 86,309,506 Y236C possibly damaging Het
Zfp160 T C 17: 21,027,008 S607P probably damaging Het
Zfp82 C A 7: 30,056,722 G312W probably damaging Het
Other mutations in Olfr859
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Olfr859 APN 9 19808396 missense probably benign 0.09
IGL00897:Olfr859 APN 9 19808621 missense probably damaging 0.97
IGL01132:Olfr859 APN 9 19808654 missense probably damaging 0.97
IGL01768:Olfr859 APN 9 19809160 missense possibly damaging 0.57
IGL02302:Olfr859 APN 9 19808685 missense probably damaging 0.97
IGL02377:Olfr859 APN 9 19809047 missense probably damaging 0.99
IGL02972:Olfr859 APN 9 19808942 missense probably damaging 0.97
R0139:Olfr859 UTSW 9 19808869 missense probably damaging 0.99
R0367:Olfr859 UTSW 9 19808543 missense probably damaging 0.99
R0521:Olfr859 UTSW 9 19808860 missense probably benign 0.00
R1196:Olfr859 UTSW 9 19808632 missense probably benign 0.00
R3742:Olfr859 UTSW 9 19808899 missense probably benign 0.44
R5567:Olfr859 UTSW 9 19808378 missense probably damaging 0.99
R6499:Olfr859 UTSW 9 19808551 missense probably benign
R6501:Olfr859 UTSW 9 19808975 missense possibly damaging 0.95
R6560:Olfr859 UTSW 9 19809116 missense probably benign
R7291:Olfr859 UTSW 9 19808648 missense possibly damaging 0.71
R7623:Olfr859 UTSW 9 19808929 missense possibly damaging 0.93
Z1177:Olfr859 UTSW 9 19808534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCATCAGCTGTGATTC -3'
(R):5'- GTTCTGGAACATCACAGAAGAAATG -3'

Sequencing Primer
(F):5'- GTGATTCCCACCTCCACAG -3'
(R):5'- CATAAAGCAGTGCACCTG -3'
Posted On2019-10-24