Incidental Mutation 'R7627:Cactin'
ID589505
Institutional Source Beutler Lab
Gene Symbol Cactin
Ensembl Gene ENSMUSG00000034889
Gene Namecactin, spliceosome C complex subunit
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.564) question?
Stock #R7627 (G1)
Quality Score217.468
Status Not validated
Chromosome10
Chromosomal Location81321103-81326242 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG to CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG at 81321318 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045469] [ENSMUST00000050867] [ENSMUST00000105327] [ENSMUST00000161854] [ENSMUST00000161869] [ENSMUST00000163075] [ENSMUST00000218120]
Predicted Effect probably benign
Transcript: ENSMUST00000045469
SMART Domains Protein: ENSMUSP00000038225
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050867
SMART Domains Protein: ENSMUSP00000059533
Gene: ENSMUSG00000034889

DomainStartEndE-ValueType
low complexity region 9 101 N/A INTRINSIC
low complexity region 128 149 N/A INTRINSIC
coiled coil region 157 184 N/A INTRINSIC
low complexity region 186 206 N/A INTRINSIC
low complexity region 246 253 N/A INTRINSIC
Pfam:Cactin_mid 292 479 2.1e-68 PFAM
low complexity region 507 524 N/A INTRINSIC
low complexity region 531 558 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
CactinC_cactus 648 772 2.13e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105327
SMART Domains Protein: ENSMUSP00000100964
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161586
SMART Domains Protein: ENSMUSP00000124612
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 54 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161854
SMART Domains Protein: ENSMUSP00000124004
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161869
SMART Domains Protein: ENSMUSP00000124235
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163075
SMART Domains Protein: ENSMUSP00000124155
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218120
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T A 14: 34,512,098 I79L unknown Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Acvrl1 G A 15: 101,135,866 R143Q probably benign Het
Adam22 A G 5: 8,367,933 S8P probably benign Het
Ankrd11 A G 8: 122,890,951 I2054T possibly damaging Het
Cad T A 5: 31,060,164 L354Q probably damaging Het
Ccdc15 A T 9: 37,342,402 C184S unknown Het
Ccl8 A G 11: 82,116,039 D26G probably benign Het
Ccsap T C 8: 123,842,358 Y248C probably damaging Het
Col5a1 T G 2: 27,950,653 Y271* probably null Het
Dnmt3b A G 2: 153,677,580 N695S probably benign Het
Dync1li2 A G 8: 104,429,508 C234R probably benign Het
Dync2h1 A T 9: 7,101,111 D2758E probably benign Het
Eif2ak3 A T 6: 70,892,935 T869S probably benign Het
Foxn4 G T 5: 114,260,434 P175H possibly damaging Het
Gbp5 T G 3: 142,500,558 M1R probably null Het
Glp2r G T 11: 67,746,763 L30I unknown Het
Gls A T 1: 52,166,266 D639E probably benign Het
Gm5145 G T 17: 20,570,392 E11* probably null Het
Gm5724 C T 6: 141,744,545 V161I probably damaging Het
Gm9772 T A 17: 22,007,179 K41N probably damaging Het
Gnat3 A T 5: 17,999,748 D133V Het
Gse1 C A 8: 120,572,777 P849T unknown Het
Hist1h2ak C A 13: 21,753,746 V28L probably benign Het
Hoxb9 A G 11: 96,274,695 T197A probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Leng9 A G 7: 4,148,618 L353P probably damaging Het
Mamdc2 A T 19: 23,310,991 M561K probably damaging Het
Mamdc4 A G 2: 25,568,213 V395A probably damaging Het
Mrpl32 G A 13: 14,612,913 R36C probably benign Het
Olfr1415 A T 1: 92,491,385 Y123* probably null Het
Olfr859 A G 9: 19,808,651 D111G probably damaging Het
Papss1 T A 3: 131,585,112 D205E probably benign Het
Pdlim2 T C 14: 70,171,475 D151G probably benign Het
Pdxp T C 15: 78,914,139 V57A probably damaging Het
Plec T A 15: 76,177,394 E2781V probably damaging Het
Prr7 GCGCCGCCGCACGCGCACCCGCACCCACACCATCACGCACTGCCGCACCCACCGCCGCCGCAC GCGCCGCCGCAC 13: 55,472,334 probably benign Het
Rnf32 G A 5: 29,197,950 probably benign Het
Ryr2 A G 13: 11,761,327 V1108A possibly damaging Het
Slc4a8 A G 15: 100,788,223 H276R probably benign Het
Spta1 T A 1: 174,205,378 D1000E probably damaging Het
Sva C A 6: 42,042,664 Q153K unknown Het
Tmprss11d T C 5: 86,309,506 Y236C possibly damaging Het
Zfp160 T C 17: 21,027,008 S607P probably damaging Het
Zfp82 C A 7: 30,056,722 G312W probably damaging Het
Other mutations in Cactin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Cactin APN 10 81324350 missense possibly damaging 0.93
IGL01631:Cactin APN 10 81323224 missense probably benign 0.03
IGL01816:Cactin APN 10 81325865 missense possibly damaging 0.81
IGL02484:Cactin APN 10 81322974 missense probably benign 0.09
IGL03001:Cactin APN 10 81325734 missense probably damaging 1.00
R0241:Cactin UTSW 10 81322652 missense probably benign
R0241:Cactin UTSW 10 81322652 missense probably benign
R0326:Cactin UTSW 10 81322662 missense probably benign 0.01
R0570:Cactin UTSW 10 81323233 missense probably damaging 0.98
R0591:Cactin UTSW 10 81324003 nonsense probably null
R1429:Cactin UTSW 10 81323678 missense probably damaging 1.00
R1444:Cactin UTSW 10 81322436 splice site probably null
R1470:Cactin UTSW 10 81323151 nonsense probably null
R1470:Cactin UTSW 10 81323151 nonsense probably null
R1630:Cactin UTSW 10 81323725 missense probably benign 0.26
R2022:Cactin UTSW 10 81322893 missense possibly damaging 0.94
R3401:Cactin UTSW 10 81325875 missense probably benign 0.07
R3402:Cactin UTSW 10 81325875 missense probably benign 0.07
R3403:Cactin UTSW 10 81325875 missense probably benign 0.07
R5284:Cactin UTSW 10 81323762 missense probably damaging 1.00
R6126:Cactin UTSW 10 81324309 missense possibly damaging 0.61
R6127:Cactin UTSW 10 81324309 missense possibly damaging 0.61
R6907:Cactin UTSW 10 81323444 critical splice donor site probably null
R7339:Cactin UTSW 10 81321318 unclassified probably benign
R7340:Cactin UTSW 10 81321318 unclassified probably benign
R7558:Cactin UTSW 10 81321318 unclassified probably benign
R7625:Cactin UTSW 10 81321318 unclassified probably benign
R7904:Cactin UTSW 10 81325865 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TTTGGACAGTCCTTAGAGCG -3'
(R):5'- ATTCGGTCCCCTATGCTCATGG -3'

Sequencing Primer
(F):5'- AGTCCTTAGAGCGCCGCG -3'
(R):5'- ATCTCGGATACTGCCCCG -3'
Posted On2019-10-24