Incidental Mutation 'R7627:Glp2r'
ID589506
Institutional Source Beutler Lab
Gene Symbol Glp2r
Ensembl Gene ENSMUSG00000049928
Gene Nameglucagon-like peptide 2 receptor
SynonymsGLP-2, 9530092J08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7627 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location67661502-67771153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 67746763 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 30 (L30I)
Ref Sequence ENSEMBL: ENSMUSP00000021289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021289] [ENSMUST00000051765]
Predicted Effect unknown
Transcript: ENSMUST00000021289
AA Change: L30I
SMART Domains Protein: ENSMUSP00000021289
Gene: ENSMUSG00000049928
AA Change: L30I

DomainStartEndE-ValueType
Pfam:7tm_2 17 225 4.8e-54 PFAM
Predicted Effect silent
Transcript: ENSMUST00000051765
SMART Domains Protein: ENSMUSP00000061560
Gene: ENSMUSG00000049928

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:HRM 53 122 3.4e-16 PFAM
Pfam:7tm_2 137 394 1.5e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor that is closely related to the glucagon receptor and binds to glucagon-like peptide-2 (GLP2). Signalling through GLP2 stimulates intestinal growth and increases villus height in the small intestine, concomitant with increased crypt cell proliferation and decreased enterocyte apoptosis. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null mutation display defects in Paneth cell physiology, increased small bowel bacterial loads, and increased susceptibility to small bowel injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T A 14: 34,512,098 I79L unknown Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Acvrl1 G A 15: 101,135,866 R143Q probably benign Het
Adam22 A G 5: 8,367,933 S8P probably benign Het
Ankrd11 A G 8: 122,890,951 I2054T possibly damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Cad T A 5: 31,060,164 L354Q probably damaging Het
Ccdc15 A T 9: 37,342,402 C184S unknown Het
Ccl8 A G 11: 82,116,039 D26G probably benign Het
Ccsap T C 8: 123,842,358 Y248C probably damaging Het
Col5a1 T G 2: 27,950,653 Y271* probably null Het
Dnmt3b A G 2: 153,677,580 N695S probably benign Het
Dync1li2 A G 8: 104,429,508 C234R probably benign Het
Dync2h1 A T 9: 7,101,111 D2758E probably benign Het
Eif2ak3 A T 6: 70,892,935 T869S probably benign Het
Foxn4 G T 5: 114,260,434 P175H possibly damaging Het
Gbp5 T G 3: 142,500,558 M1R probably null Het
Gls A T 1: 52,166,266 D639E probably benign Het
Gm5145 G T 17: 20,570,392 E11* probably null Het
Gm5724 C T 6: 141,744,545 V161I probably damaging Het
Gm9772 T A 17: 22,007,179 K41N probably damaging Het
Gnat3 A T 5: 17,999,748 D133V Het
Gse1 C A 8: 120,572,777 P849T unknown Het
Hist1h2ak C A 13: 21,753,746 V28L probably benign Het
Hoxb9 A G 11: 96,274,695 T197A probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Leng9 A G 7: 4,148,618 L353P probably damaging Het
Mamdc2 A T 19: 23,310,991 M561K probably damaging Het
Mamdc4 A G 2: 25,568,213 V395A probably damaging Het
Mrpl32 G A 13: 14,612,913 R36C probably benign Het
Olfr1415 A T 1: 92,491,385 Y123* probably null Het
Olfr859 A G 9: 19,808,651 D111G probably damaging Het
Papss1 T A 3: 131,585,112 D205E probably benign Het
Pdlim2 T C 14: 70,171,475 D151G probably benign Het
Pdxp T C 15: 78,914,139 V57A probably damaging Het
Plec T A 15: 76,177,394 E2781V probably damaging Het
Prr7 GCGCCGCCGCACGCGCACCCGCACCCACACCATCACGCACTGCCGCACCCACCGCCGCCGCAC GCGCCGCCGCAC 13: 55,472,334 probably benign Het
Rnf32 G A 5: 29,197,950 probably benign Het
Ryr2 A G 13: 11,761,327 V1108A possibly damaging Het
Slc4a8 A G 15: 100,788,223 H276R probably benign Het
Spta1 T A 1: 174,205,378 D1000E probably damaging Het
Sva C A 6: 42,042,664 Q153K unknown Het
Tmprss11d T C 5: 86,309,506 Y236C possibly damaging Het
Zfp160 T C 17: 21,027,008 S607P probably damaging Het
Zfp82 C A 7: 30,056,722 G312W probably damaging Het
Other mutations in Glp2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Glp2r APN 11 67709644 missense probably benign
IGL02244:Glp2r APN 11 67721991 missense probably damaging 1.00
IGL02484:Glp2r APN 11 67740166 missense possibly damaging 0.90
R0013:Glp2r UTSW 11 67709712 missense possibly damaging 0.88
R0013:Glp2r UTSW 11 67709712 missense possibly damaging 0.88
R0195:Glp2r UTSW 11 67709708 missense probably damaging 0.99
R1612:Glp2r UTSW 11 67742207 missense possibly damaging 0.46
R1699:Glp2r UTSW 11 67757541 missense probably benign 0.09
R1944:Glp2r UTSW 11 67746792 missense probably benign 0.01
R3971:Glp2r UTSW 11 67746815 missense possibly damaging 0.65
R4417:Glp2r UTSW 11 67664516 intron probably benign
R4681:Glp2r UTSW 11 67730627 splice site probably null
R4914:Glp2r UTSW 11 67757593 nonsense probably null
R4918:Glp2r UTSW 11 67757593 nonsense probably null
R4938:Glp2r UTSW 11 67757593 nonsense probably null
R4940:Glp2r UTSW 11 67757593 nonsense probably null
R4941:Glp2r UTSW 11 67746703 splice site probably null
R4963:Glp2r UTSW 11 67757593 nonsense probably null
R4966:Glp2r UTSW 11 67757593 nonsense probably null
R5023:Glp2r UTSW 11 67741032 missense possibly damaging 0.82
R5121:Glp2r UTSW 11 67722100 splice site probably null
R5313:Glp2r UTSW 11 67757531 missense probably damaging 0.96
R5705:Glp2r UTSW 11 67709739 missense probably benign 0.30
R5790:Glp2r UTSW 11 67764799 missense probably damaging 1.00
R6074:Glp2r UTSW 11 67746814 missense unknown
R6595:Glp2r UTSW 11 67764777 missense probably benign 0.10
R6910:Glp2r UTSW 11 67730671 missense probably benign 0.28
R7511:Glp2r UTSW 11 67757591 missense probably damaging 0.98
R7681:Glp2r UTSW 11 67709679 missense probably benign 0.45
R7779:Glp2r UTSW 11 67709783 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCAAGAATCTCAAGCTTCCTGC -3'
(R):5'- GCTGCCTATTTGGGTATCAACG -3'

Sequencing Primer
(F):5'- TGCTCTGAAGATCCATGACATC -3'
(R):5'- AGGTCTAAAGACAGGCTGGG -3'
Posted On2019-10-24