Incidental Mutation 'R7627:Hoxb9'
ID589508
Institutional Source Beutler Lab
Gene Symbol Hoxb9
Ensembl Gene ENSMUSG00000020875
Gene Namehomeobox B9
SynonymsHox-2.5
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.698) question?
Stock #R7627 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location96271457-96276595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96274695 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 197 (T197A)
Ref Sequence ENSEMBL: ENSMUSP00000000010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000010] [ENSMUST00000174042]
Predicted Effect probably damaging
Transcript: ENSMUST00000000010
AA Change: T197A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000010
Gene: ENSMUSG00000020875
AA Change: T197A

DomainStartEndE-ValueType
Pfam:Hox9_act 1 172 2.1e-59 PFAM
HOX 185 247 2.68e-27 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174042
AA Change: D117G
SMART Domains Protein: ENSMUSP00000133919
Gene: ENSMUSG00000020875
AA Change: D117G

DomainStartEndE-ValueType
Pfam:Hox9_act 1 96 5e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Abd-B homeobox family and encodes a protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded nuclear protein functions as a sequence-specific transcription factor that is involved in cell proliferation and differentiation. Increased expression of this gene is associated with some cases of leukemia, prostate cancer and lung cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations affect developing thoracic skeletal elements. Homozygotes exhibit rib fusion, abnormal rib attachment to the sternum, and reduced intercostal segments of the sternum. Homozygotes or heterozygotes may show an eighth rib attached to the sternum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T A 14: 34,512,098 I79L unknown Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Acvrl1 G A 15: 101,135,866 R143Q probably benign Het
Adam22 A G 5: 8,367,933 S8P probably benign Het
Ankrd11 A G 8: 122,890,951 I2054T possibly damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Cad T A 5: 31,060,164 L354Q probably damaging Het
Ccdc15 A T 9: 37,342,402 C184S unknown Het
Ccl8 A G 11: 82,116,039 D26G probably benign Het
Ccsap T C 8: 123,842,358 Y248C probably damaging Het
Col5a1 T G 2: 27,950,653 Y271* probably null Het
Dnmt3b A G 2: 153,677,580 N695S probably benign Het
Dync1li2 A G 8: 104,429,508 C234R probably benign Het
Dync2h1 A T 9: 7,101,111 D2758E probably benign Het
Eif2ak3 A T 6: 70,892,935 T869S probably benign Het
Foxn4 G T 5: 114,260,434 P175H possibly damaging Het
Gbp5 T G 3: 142,500,558 M1R probably null Het
Glp2r G T 11: 67,746,763 L30I unknown Het
Gls A T 1: 52,166,266 D639E probably benign Het
Gm5145 G T 17: 20,570,392 E11* probably null Het
Gm5724 C T 6: 141,744,545 V161I probably damaging Het
Gm9772 T A 17: 22,007,179 K41N probably damaging Het
Gnat3 A T 5: 17,999,748 D133V Het
Gse1 C A 8: 120,572,777 P849T unknown Het
Hist1h2ak C A 13: 21,753,746 V28L probably benign Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Leng9 A G 7: 4,148,618 L353P probably damaging Het
Mamdc2 A T 19: 23,310,991 M561K probably damaging Het
Mamdc4 A G 2: 25,568,213 V395A probably damaging Het
Mrpl32 G A 13: 14,612,913 R36C probably benign Het
Olfr1415 A T 1: 92,491,385 Y123* probably null Het
Olfr859 A G 9: 19,808,651 D111G probably damaging Het
Papss1 T A 3: 131,585,112 D205E probably benign Het
Pdlim2 T C 14: 70,171,475 D151G probably benign Het
Pdxp T C 15: 78,914,139 V57A probably damaging Het
Plec T A 15: 76,177,394 E2781V probably damaging Het
Prr7 GCGCCGCCGCACGCGCACCCGCACCCACACCATCACGCACTGCCGCACCCACCGCCGCCGCAC GCGCCGCCGCAC 13: 55,472,334 probably benign Het
Rnf32 G A 5: 29,197,950 probably benign Het
Ryr2 A G 13: 11,761,327 V1108A possibly damaging Het
Slc4a8 A G 15: 100,788,223 H276R probably benign Het
Spta1 T A 1: 174,205,378 D1000E probably damaging Het
Sva C A 6: 42,042,664 Q153K unknown Het
Tmprss11d T C 5: 86,309,506 Y236C possibly damaging Het
Zfp160 T C 17: 21,027,008 S607P probably damaging Het
Zfp82 C A 7: 30,056,722 G312W probably damaging Het
Other mutations in Hoxb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01487:Hoxb9 APN 11 96274788 nonsense probably null
IGL02251:Hoxb9 APN 11 96274825 missense probably damaging 1.00
IGL02738:Hoxb9 APN 11 96274728 missense possibly damaging 0.87
R1467:Hoxb9 UTSW 11 96271938 missense probably benign
R1467:Hoxb9 UTSW 11 96271938 missense probably benign
R1958:Hoxb9 UTSW 11 96272054 missense possibly damaging 0.88
R4419:Hoxb9 UTSW 11 96271981 missense probably benign 0.00
R4420:Hoxb9 UTSW 11 96271981 missense probably benign 0.00
R4666:Hoxb9 UTSW 11 96274831 missense possibly damaging 0.94
R7821:Hoxb9 UTSW 11 96271711 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGTTTCTCCAATGCCAGGG -3'
(R):5'- TACAACCCAGACAGCAGTGG -3'

Sequencing Primer
(F):5'- TTCTCCAATGCCAGGGGAGTAG -3'
(R):5'- GCAGTGGCTTTTTGACCATCAC -3'
Posted On2019-10-24