Incidental Mutation 'R7627:Krt39'
ID589509
Institutional Source Beutler Lab
Gene Symbol Krt39
Ensembl Gene ENSMUSG00000064165
Gene Namekeratin 39
Synonyms4732494G06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7627 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location99514114-99521338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99514749 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 442 (S442P)
Ref Sequence ENSEMBL: ENSMUSP00000103069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076948] [ENSMUST00000107445]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076948
AA Change: S442P

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076216
Gene: ENSMUSG00000064165
AA Change: S442P

DomainStartEndE-ValueType
Pfam:Filament 90 401 7.9e-96 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107445
AA Change: S442P

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103069
Gene: ENSMUSG00000064165
AA Change: S442P

DomainStartEndE-ValueType
Filament 90 401 2.63e-130 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T A 14: 34,512,098 I79L unknown Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Acvrl1 G A 15: 101,135,866 R143Q probably benign Het
Adam22 A G 5: 8,367,933 S8P probably benign Het
Ankrd11 A G 8: 122,890,951 I2054T possibly damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Cad T A 5: 31,060,164 L354Q probably damaging Het
Ccdc15 A T 9: 37,342,402 C184S unknown Het
Ccl8 A G 11: 82,116,039 D26G probably benign Het
Ccsap T C 8: 123,842,358 Y248C probably damaging Het
Col5a1 T G 2: 27,950,653 Y271* probably null Het
Dnmt3b A G 2: 153,677,580 N695S probably benign Het
Dync1li2 A G 8: 104,429,508 C234R probably benign Het
Dync2h1 A T 9: 7,101,111 D2758E probably benign Het
Eif2ak3 A T 6: 70,892,935 T869S probably benign Het
Foxn4 G T 5: 114,260,434 P175H possibly damaging Het
Gbp5 T G 3: 142,500,558 M1R probably null Het
Glp2r G T 11: 67,746,763 L30I unknown Het
Gls A T 1: 52,166,266 D639E probably benign Het
Gm5145 G T 17: 20,570,392 E11* probably null Het
Gm5724 C T 6: 141,744,545 V161I probably damaging Het
Gm9772 T A 17: 22,007,179 K41N probably damaging Het
Gnat3 A T 5: 17,999,748 D133V Het
Gse1 C A 8: 120,572,777 P849T unknown Het
Hist1h2ak C A 13: 21,753,746 V28L probably benign Het
Hoxb9 A G 11: 96,274,695 T197A probably damaging Het
Leng9 A G 7: 4,148,618 L353P probably damaging Het
Mamdc2 A T 19: 23,310,991 M561K probably damaging Het
Mamdc4 A G 2: 25,568,213 V395A probably damaging Het
Mrpl32 G A 13: 14,612,913 R36C probably benign Het
Olfr1415 A T 1: 92,491,385 Y123* probably null Het
Olfr859 A G 9: 19,808,651 D111G probably damaging Het
Papss1 T A 3: 131,585,112 D205E probably benign Het
Pdlim2 T C 14: 70,171,475 D151G probably benign Het
Pdxp T C 15: 78,914,139 V57A probably damaging Het
Plec T A 15: 76,177,394 E2781V probably damaging Het
Prr7 GCGCCGCCGCACGCGCACCCGCACCCACACCATCACGCACTGCCGCACCCACCGCCGCCGCAC GCGCCGCCGCAC 13: 55,472,334 probably benign Het
Rnf32 G A 5: 29,197,950 probably benign Het
Ryr2 A G 13: 11,761,327 V1108A possibly damaging Het
Slc4a8 A G 15: 100,788,223 H276R probably benign Het
Spta1 T A 1: 174,205,378 D1000E probably damaging Het
Sva C A 6: 42,042,664 Q153K unknown Het
Tmprss11d T C 5: 86,309,506 Y236C possibly damaging Het
Zfp160 T C 17: 21,027,008 S607P probably damaging Het
Zfp82 C A 7: 30,056,722 G312W probably damaging Het
Other mutations in Krt39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Krt39 APN 11 99519063 missense probably damaging 0.97
IGL02179:Krt39 APN 11 99520841 missense probably damaging 1.00
IGL02478:Krt39 APN 11 99520897 missense probably benign 0.37
IGL02578:Krt39 APN 11 99521206 missense probably benign 0.00
IGL03090:Krt39 APN 11 99519007 splice site probably benign
IGL03094:Krt39 APN 11 99520802 splice site probably benign
R0532:Krt39 UTSW 11 99514791 missense possibly damaging 0.92
R0789:Krt39 UTSW 11 99521062 missense probably benign 0.00
R1856:Krt39 UTSW 11 99519088 nonsense probably null
R1920:Krt39 UTSW 11 99514635 missense probably benign 0.00
R1944:Krt39 UTSW 11 99519823 missense probably damaging 1.00
R4391:Krt39 UTSW 11 99514752 missense probably benign 0.01
R4678:Krt39 UTSW 11 99521000 missense probably benign 0.02
R4921:Krt39 UTSW 11 99514749 missense possibly damaging 0.80
R5800:Krt39 UTSW 11 99521145 missense probably benign 0.09
R6207:Krt39 UTSW 11 99521215 missense probably damaging 1.00
R6904:Krt39 UTSW 11 99519821 missense probably damaging 1.00
R7034:Krt39 UTSW 11 99521236 missense probably benign 0.19
R7036:Krt39 UTSW 11 99521236 missense probably benign 0.19
R7131:Krt39 UTSW 11 99520871 missense probably benign
R7424:Krt39 UTSW 11 99518091 missense probably damaging 1.00
R7449:Krt39 UTSW 11 99518061 missense probably benign 0.02
R7774:Krt39 UTSW 11 99514611 splice site probably null
R7784:Krt39 UTSW 11 99521031 nonsense probably null
R7827:Krt39 UTSW 11 99519075 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCTCTCTTTCATGAATGGAG -3'
(R):5'- TGAAGACTTAGCCACTCCCATC -3'

Sequencing Primer
(F):5'- ATGGAGGTCATTCTTATCACCTTGAG -3'
(R):5'- CGATCACTAAAATTCTGTTGCTGC -3'
Posted On2019-10-24