Incidental Mutation 'R7627:Pdxp'
ID589517
Institutional Source Beutler Lab
Gene Symbol Pdxp
Ensembl Gene ENSMUSG00000116165
Gene Name
Synonyms1600027H05Rik, chronophilin, PLP-phosophatase
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7627 (G1)
Quality Score119.008
Status Not validated
Chromosome15
Chromosomal Location78913919-78919517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78914139 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 57 (V57A)
Ref Sequence ENSEMBL: ENSMUSP00000086796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001226] [ENSMUST00000061239] [ENSMUST00000089378] [ENSMUST00000109698] [ENSMUST00000132047] [ENSMUST00000134703] [ENSMUST00000151146]
PDB Structure
Crystal structure of the murine AUM (phosphoglycolate phosphatase) capping domain as a fusion protein with the catalytic core domain of murine chronophin (pyridoxal phosphate phosphatase) [X-RAY DIFFRACTION]
Crystal Structure of a Monomeric Variant of murine Chronophin (Pyridoxal Phosphate phosphatase) [X-RAY DIFFRACTION]
Crystal Structure of murine Chronophin (Pyridoxal Phosphate Phosphatase) in complex with Beryllium trifluoride [X-RAY DIFFRACTION]
Crystal Structure of murine Chronophin (Pyridoxal Phosphate Phosphatase) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000001226
SMART Domains Protein: ENSMUSP00000001226
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Pfam:BAR 2 254 7e-37 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
low complexity region 558 593 N/A INTRINSIC
low complexity region 604 633 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061239
SMART Domains Protein: ENSMUSP00000052181
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Pfam:BAR 2 254 2.2e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089378
AA Change: V57A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086796
Gene: ENSMUSG00000116165
AA Change: V57A

DomainStartEndE-ValueType
Pfam:Hydrolase 19 247 3.6e-13 PFAM
Pfam:Hydrolase_6 22 128 3.2e-29 PFAM
Pfam:Hydrolase_like 206 286 2.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109698
SMART Domains Protein: ENSMUSP00000105320
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Pfam:BAR 2 254 2.2e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132047
SMART Domains Protein: ENSMUSP00000138598
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Pfam:BAR 2 254 5.4e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134703
Predicted Effect probably benign
Transcript: ENSMUST00000151146
SMART Domains Protein: ENSMUSP00000138780
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Pfam:BAR 2 143 9e-22 PFAM
low complexity region 160 177 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pyridoxal 5-prime-phosphate (PLP) is the active form of vitamin B6 that acts as a coenzyme in maintaining biochemical homeostasis. The preferred degradation route from PLP to 4-pyridoxic acid involves the dephosphorylation of PLP by PDXP (Jang et al., 2003 [PubMed 14522954]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T A 14: 34,512,098 I79L unknown Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Acvrl1 G A 15: 101,135,866 R143Q probably benign Het
Adam22 A G 5: 8,367,933 S8P probably benign Het
Ankrd11 A G 8: 122,890,951 I2054T possibly damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Cad T A 5: 31,060,164 L354Q probably damaging Het
Ccdc15 A T 9: 37,342,402 C184S unknown Het
Ccl8 A G 11: 82,116,039 D26G probably benign Het
Ccsap T C 8: 123,842,358 Y248C probably damaging Het
Col5a1 T G 2: 27,950,653 Y271* probably null Het
Dnmt3b A G 2: 153,677,580 N695S probably benign Het
Dync1li2 A G 8: 104,429,508 C234R probably benign Het
Dync2h1 A T 9: 7,101,111 D2758E probably benign Het
Eif2ak3 A T 6: 70,892,935 T869S probably benign Het
Foxn4 G T 5: 114,260,434 P175H possibly damaging Het
Gbp5 T G 3: 142,500,558 M1R probably null Het
Glp2r G T 11: 67,746,763 L30I unknown Het
Gls A T 1: 52,166,266 D639E probably benign Het
Gm5145 G T 17: 20,570,392 E11* probably null Het
Gm5724 C T 6: 141,744,545 V161I probably damaging Het
Gm9772 T A 17: 22,007,179 K41N probably damaging Het
Gnat3 A T 5: 17,999,748 D133V Het
Gse1 C A 8: 120,572,777 P849T unknown Het
Hist1h2ak C A 13: 21,753,746 V28L probably benign Het
Hoxb9 A G 11: 96,274,695 T197A probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Leng9 A G 7: 4,148,618 L353P probably damaging Het
Mamdc2 A T 19: 23,310,991 M561K probably damaging Het
Mamdc4 A G 2: 25,568,213 V395A probably damaging Het
Mrpl32 G A 13: 14,612,913 R36C probably benign Het
Olfr1415 A T 1: 92,491,385 Y123* probably null Het
Olfr859 A G 9: 19,808,651 D111G probably damaging Het
Papss1 T A 3: 131,585,112 D205E probably benign Het
Pdlim2 T C 14: 70,171,475 D151G probably benign Het
Plec T A 15: 76,177,394 E2781V probably damaging Het
Prr7 GCGCCGCCGCACGCGCACCCGCACCCACACCATCACGCACTGCCGCACCCACCGCCGCCGCAC GCGCCGCCGCAC 13: 55,472,334 probably benign Het
Rnf32 G A 5: 29,197,950 probably benign Het
Ryr2 A G 13: 11,761,327 V1108A possibly damaging Het
Slc4a8 A G 15: 100,788,223 H276R probably benign Het
Spta1 T A 1: 174,205,378 D1000E probably damaging Het
Sva C A 6: 42,042,664 Q153K unknown Het
Tmprss11d T C 5: 86,309,506 Y236C possibly damaging Het
Zfp160 T C 17: 21,027,008 S607P probably damaging Het
Zfp82 C A 7: 30,056,722 G312W probably damaging Het
Other mutations in Pdxp
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4802001:Pdxp UTSW 15 78918411 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGTGAAGCTGCCCCTTG -3'
(R):5'- AAAACTGCTCGTCGTAGCC -3'

Sequencing Primer
(F):5'- GAAGCTGCCCCTTGTCCAC -3'
(R):5'- TAGCCTACGAGCACGGC -3'
Posted On2019-10-24