Incidental Mutation 'R7627:Slc4a8'
ID589518
Institutional Source Beutler Lab
Gene Symbol Slc4a8
Ensembl Gene ENSMUSG00000023032
Gene Namesolute carrier family 4 (anion exchanger), member 8
SynonymsNDCBE, KNBC-3, sodium bicarbonate cotransporter isoform 3 kNBC-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R7627 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location100761747-100823968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100788223 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 276 (H276R)
Ref Sequence ENSEMBL: ENSMUSP00000023776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023776] [ENSMUST00000162049]
Predicted Effect probably benign
Transcript: ENSMUST00000023776
AA Change: H276R

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000023776
Gene: ENSMUSG00000023032
AA Change: H276R

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
Pfam:Band_3_cyto 145 402 1.4e-105 PFAM
Pfam:HCO3_cotransp 443 956 9.6e-247 PFAM
transmembrane domain 964 986 N/A INTRINSIC
low complexity region 1010 1027 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162049
AA Change: H224R

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125090
Gene: ENSMUSG00000023032
AA Change: H224R

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
Pfam:Band_3_cyto 93 350 6.5e-103 PFAM
Pfam:HCO3_cotransp 390 904 1.6e-251 PFAM
transmembrane domain 912 934 N/A INTRINSIC
low complexity region 958 975 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that functions to transport sodium and bicarbonate ions across the cell membrane. The encoded protein is important for pH regulation in neurons. The activity of this protein can be inhibited by 4,4'-Di-isothiocyanatostilbene-2,2'-disulfonic acid (DIDS). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal sodium and chloride ion excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T A 14: 34,512,098 I79L unknown Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Acvrl1 G A 15: 101,135,866 R143Q probably benign Het
Adam22 A G 5: 8,367,933 S8P probably benign Het
Ankrd11 A G 8: 122,890,951 I2054T possibly damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Cad T A 5: 31,060,164 L354Q probably damaging Het
Ccdc15 A T 9: 37,342,402 C184S unknown Het
Ccl8 A G 11: 82,116,039 D26G probably benign Het
Ccsap T C 8: 123,842,358 Y248C probably damaging Het
Col5a1 T G 2: 27,950,653 Y271* probably null Het
Dnmt3b A G 2: 153,677,580 N695S probably benign Het
Dync1li2 A G 8: 104,429,508 C234R probably benign Het
Dync2h1 A T 9: 7,101,111 D2758E probably benign Het
Eif2ak3 A T 6: 70,892,935 T869S probably benign Het
Foxn4 G T 5: 114,260,434 P175H possibly damaging Het
Gbp5 T G 3: 142,500,558 M1R probably null Het
Glp2r G T 11: 67,746,763 L30I unknown Het
Gls A T 1: 52,166,266 D639E probably benign Het
Gm5145 G T 17: 20,570,392 E11* probably null Het
Gm5724 C T 6: 141,744,545 V161I probably damaging Het
Gm9772 T A 17: 22,007,179 K41N probably damaging Het
Gnat3 A T 5: 17,999,748 D133V Het
Gse1 C A 8: 120,572,777 P849T unknown Het
Hist1h2ak C A 13: 21,753,746 V28L probably benign Het
Hoxb9 A G 11: 96,274,695 T197A probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Leng9 A G 7: 4,148,618 L353P probably damaging Het
Mamdc2 A T 19: 23,310,991 M561K probably damaging Het
Mamdc4 A G 2: 25,568,213 V395A probably damaging Het
Mrpl32 G A 13: 14,612,913 R36C probably benign Het
Olfr1415 A T 1: 92,491,385 Y123* probably null Het
Olfr859 A G 9: 19,808,651 D111G probably damaging Het
Papss1 T A 3: 131,585,112 D205E probably benign Het
Pdlim2 T C 14: 70,171,475 D151G probably benign Het
Pdxp T C 15: 78,914,139 V57A probably damaging Het
Plec T A 15: 76,177,394 E2781V probably damaging Het
Prr7 GCGCCGCCGCACGCGCACCCGCACCCACACCATCACGCACTGCCGCACCCACCGCCGCCGCAC GCGCCGCCGCAC 13: 55,472,334 probably benign Het
Rnf32 G A 5: 29,197,950 probably benign Het
Ryr2 A G 13: 11,761,327 V1108A possibly damaging Het
Spta1 T A 1: 174,205,378 D1000E probably damaging Het
Sva C A 6: 42,042,664 Q153K unknown Het
Tmprss11d T C 5: 86,309,506 Y236C possibly damaging Het
Zfp160 T C 17: 21,027,008 S607P probably damaging Het
Zfp82 C A 7: 30,056,722 G312W probably damaging Het
Other mutations in Slc4a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Slc4a8 APN 15 100807438 missense possibly damaging 0.50
IGL01633:Slc4a8 APN 15 100787247 missense probably damaging 1.00
IGL02945:Slc4a8 APN 15 100807199 critical splice acceptor site probably null
IGL03172:Slc4a8 APN 15 100799717 missense probably benign
R0008:Slc4a8 UTSW 15 100800493 missense possibly damaging 0.67
R0040:Slc4a8 UTSW 15 100789846 missense probably damaging 0.98
R0040:Slc4a8 UTSW 15 100789846 missense probably damaging 0.98
R0257:Slc4a8 UTSW 15 100784880 splice site probably benign
R0393:Slc4a8 UTSW 15 100774638 missense probably damaging 0.99
R0508:Slc4a8 UTSW 15 100789092 missense probably benign 0.01
R0639:Slc4a8 UTSW 15 100796550 missense probably damaging 1.00
R1640:Slc4a8 UTSW 15 100783787 missense probably benign 0.13
R1692:Slc4a8 UTSW 15 100800573 missense probably damaging 1.00
R1766:Slc4a8 UTSW 15 100787212 missense probably benign 0.00
R1955:Slc4a8 UTSW 15 100807376 missense probably damaging 1.00
R2157:Slc4a8 UTSW 15 100806373 missense probably damaging 1.00
R2206:Slc4a8 UTSW 15 100807445 missense probably damaging 1.00
R2229:Slc4a8 UTSW 15 100809299 missense probably damaging 1.00
R2274:Slc4a8 UTSW 15 100807402 missense probably benign 0.00
R2275:Slc4a8 UTSW 15 100807402 missense probably benign 0.00
R4299:Slc4a8 UTSW 15 100796640 critical splice donor site probably null
R4482:Slc4a8 UTSW 15 100810599 missense probably damaging 1.00
R5038:Slc4a8 UTSW 15 100795821 missense probably damaging 0.98
R5586:Slc4a8 UTSW 15 100787164 missense probably damaging 1.00
R5594:Slc4a8 UTSW 15 100795887 missense probably damaging 1.00
R5804:Slc4a8 UTSW 15 100791625 missense possibly damaging 0.71
R5815:Slc4a8 UTSW 15 100788211 missense probably benign 0.42
R5921:Slc4a8 UTSW 15 100814447 splice site probably benign
R6029:Slc4a8 UTSW 15 100807339 missense probably benign 0.00
R6212:Slc4a8 UTSW 15 100811571 missense possibly damaging 0.69
R6321:Slc4a8 UTSW 15 100789164 missense probably damaging 0.99
R6574:Slc4a8 UTSW 15 100807316 missense probably damaging 1.00
R6829:Slc4a8 UTSW 15 100800538 missense probably damaging 1.00
R7023:Slc4a8 UTSW 15 100791643 missense probably benign 0.00
R7082:Slc4a8 UTSW 15 100791027 missense probably damaging 1.00
R7197:Slc4a8 UTSW 15 100790976 missense probably damaging 1.00
R7352:Slc4a8 UTSW 15 100790984 missense probably damaging 1.00
R7391:Slc4a8 UTSW 15 100784862 missense probably damaging 0.98
R7810:Slc4a8 UTSW 15 100798178 missense possibly damaging 0.72
R8026:Slc4a8 UTSW 15 100787289 missense possibly damaging 0.72
Z1088:Slc4a8 UTSW 15 100761951 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTACCATTAAGTGCGTGGGGAC -3'
(R):5'- ACCGTCCTGACAACTTGAAGATG -3'

Sequencing Primer
(F):5'- TGTGAAGGGACCCTGCTC -3'
(R):5'- CGTCCTGACAACTTGAAGATGAGAAG -3'
Posted On2019-10-24