Incidental Mutation 'R7629:Brox'
ID 589526
Institutional Source Beutler Lab
Gene Symbol Brox
Ensembl Gene ENSMUSG00000046836
Gene Name BRO1 domain and CAAX motif containing
Synonyms 0610010K06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 183276352-183297269 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 183292504 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 60 (A60V)
Ref Sequence ENSEMBL: ENSMUSP00000061345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057062] [ENSMUST00000109166] [ENSMUST00000163528] [ENSMUST00000192829] [ENSMUST00000193625] [ENSMUST00000194327] [ENSMUST00000195054]
AlphaFold Q8K2Q7
Predicted Effect probably damaging
Transcript: ENSMUST00000057062
AA Change: A60V

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000061345
Gene: ENSMUSG00000046836
AA Change: A60V

DomainStartEndE-ValueType
BRO1 4 384 1.74e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109166
SMART Domains Protein: ENSMUSP00000104795
Gene: ENSMUSG00000042901

DomainStartEndE-ValueType
Pfam:Aida_N 9 112 1.9e-43 PFAM
low complexity region 122 144 N/A INTRINSIC
Pfam:Aida_C2 155 300 2.4e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163528
AA Change: A60V

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132333
Gene: ENSMUSG00000046836
AA Change: A60V

DomainStartEndE-ValueType
PDB:3ZXP|C 1 101 5e-63 PDB
Blast:BRO1 4 101 1e-67 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000192829
AA Change: A60V

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141585
Gene: ENSMUSG00000046836
AA Change: A60V

DomainStartEndE-ValueType
PDB:3ZXP|C 1 91 4e-55 PDB
Blast:BRO1 4 91 9e-59 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193625
SMART Domains Protein: ENSMUSP00000141649
Gene: ENSMUSG00000042901

DomainStartEndE-ValueType
Pfam:Aida_N 8 113 2.3e-49 PFAM
low complexity region 122 144 N/A INTRINSIC
Pfam:Aida_C2 145 219 6.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194327
Predicted Effect probably benign
Transcript: ENSMUST00000195054
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Brox
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0854:Brox UTSW 1 183287758 missense possibly damaging 0.50
R1086:Brox UTSW 1 183282488 missense probably damaging 1.00
R4488:Brox UTSW 1 183280950 missense probably benign 0.01
R4524:Brox UTSW 1 183292481 missense possibly damaging 0.95
R5112:Brox UTSW 1 183291977 missense probably benign
R5559:Brox UTSW 1 183291988 missense possibly damaging 0.83
R5951:Brox UTSW 1 183282508 missense probably damaging 1.00
R7027:Brox UTSW 1 183284186 missense possibly damaging 0.92
R7029:Brox UTSW 1 183284186 missense possibly damaging 0.92
R7229:Brox UTSW 1 183291959 nonsense probably null
R7935:Brox UTSW 1 183280920 missense probably damaging 0.98
R8140:Brox UTSW 1 183293873 splice site probably null
R8164:Brox UTSW 1 183280927 missense possibly damaging 0.95
R9430:Brox UTSW 1 183287789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAATGACACTTCTGGTACC -3'
(R):5'- GCTTTTGACAAGAAGGTAGCGG -3'

Sequencing Primer
(F):5'- GGAATGACACTTCTGGTACCGTTTTC -3'
(R):5'- TTTGACAAGAAGGTAGCGGGATCTG -3'
Posted On 2019-10-24