Incidental Mutation 'R7629:Abtb2'
ID 589529
Institutional Source Beutler Lab
Gene Symbol Abtb2
Ensembl Gene ENSMUSG00000032724
Gene Name ankyrin repeat and BTB (POZ) domain containing 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 103566310-103718423 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 103683493 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076212] [ENSMUST00000076212]
AlphaFold Q7TQI7
Predicted Effect probably null
Transcript: ENSMUST00000076212
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076212
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Abtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Abtb2 APN 2 103705118 missense probably benign 0.00
IGL02605:Abtb2 APN 2 103717257 missense probably benign
IGL03161:Abtb2 APN 2 103567454 missense probably benign 0.02
PIT4504001:Abtb2 UTSW 2 103717192 nonsense probably null
R0147:Abtb2 UTSW 2 103567135 missense probably benign 0.04
R1052:Abtb2 UTSW 2 103705072 missense possibly damaging 0.46
R1419:Abtb2 UTSW 2 103709420 missense probably benign 0.00
R1518:Abtb2 UTSW 2 103709284 missense probably benign 0.03
R1650:Abtb2 UTSW 2 103702402 missense probably damaging 1.00
R1795:Abtb2 UTSW 2 103567024 missense probably benign 0.00
R2054:Abtb2 UTSW 2 103705117 missense probably benign 0.41
R2101:Abtb2 UTSW 2 103566862 missense probably benign 0.05
R2363:Abtb2 UTSW 2 103567183 missense probably damaging 1.00
R3440:Abtb2 UTSW 2 103567232 missense probably benign 0.43
R3927:Abtb2 UTSW 2 103708218 splice site probably null
R4351:Abtb2 UTSW 2 103683393 missense possibly damaging 0.46
R4352:Abtb2 UTSW 2 103683393 missense possibly damaging 0.46
R4782:Abtb2 UTSW 2 103717299 missense probably benign 0.35
R4814:Abtb2 UTSW 2 103717287 missense probably benign 0.08
R4831:Abtb2 UTSW 2 103683475 missense probably benign 0.06
R4900:Abtb2 UTSW 2 103567004 missense possibly damaging 0.62
R5038:Abtb2 UTSW 2 103567063 missense probably damaging 0.99
R5513:Abtb2 UTSW 2 103709278 critical splice acceptor site probably null
R6119:Abtb2 UTSW 2 103702310 missense probably benign 0.00
R6298:Abtb2 UTSW 2 103709488 missense probably benign 0.10
R6383:Abtb2 UTSW 2 103567376 missense probably damaging 0.98
R6860:Abtb2 UTSW 2 103709425 nonsense probably null
R7000:Abtb2 UTSW 2 103712442 missense possibly damaging 0.85
R7109:Abtb2 UTSW 2 103715515 missense probably benign 0.20
R7176:Abtb2 UTSW 2 103709375 missense probably benign 0.00
R7189:Abtb2 UTSW 2 103567516 missense probably benign 0.00
R7199:Abtb2 UTSW 2 103567220 missense possibly damaging 0.74
R7299:Abtb2 UTSW 2 103702424 splice site probably null
R7347:Abtb2 UTSW 2 103567412 missense probably damaging 1.00
R7469:Abtb2 UTSW 2 103566947 missense probably benign 0.00
R7862:Abtb2 UTSW 2 103702281 missense probably damaging 1.00
R8200:Abtb2 UTSW 2 103700817 missense probably benign 0.02
R8682:Abtb2 UTSW 2 103567375 missense probably benign 0.36
R8700:Abtb2 UTSW 2 103566944 missense probably damaging 0.99
R9164:Abtb2 UTSW 2 103711484 missense possibly damaging 0.50
R9196:Abtb2 UTSW 2 103683302 missense possibly damaging 0.71
R9254:Abtb2 UTSW 2 103711235 missense probably benign 0.00
R9258:Abtb2 UTSW 2 103716065 missense probably null 0.99
R9427:Abtb2 UTSW 2 103700899 missense probably damaging 1.00
Z1176:Abtb2 UTSW 2 103708172 nonsense probably null
Z1177:Abtb2 UTSW 2 103711196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCTGGTCTCTCGAGCCATG -3'
(R):5'- ACACATCTGCCCTGGTAAAG -3'

Sequencing Primer
(F):5'- TCTCTCGAGCCATGCACCAC -3'
(R):5'- TGCCCTGGTAAAGAAATATATTACAC -3'
Posted On 2019-10-24