Incidental Mutation 'R7629:Abtb2'
ID 589529
Institutional Source Beutler Lab
Gene Symbol Abtb2
Ensembl Gene ENSMUSG00000032724
Gene Name ankyrin repeat and BTB domain containing 2
Synonyms BPOZ-2
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 103396655-103548768 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 103513838 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076212] [ENSMUST00000076212]
AlphaFold Q7TQI7
Predicted Effect probably null
Transcript: ENSMUST00000076212
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076212
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,504,293 (GRCm39) T168I probably benign Het
Ankrd10 A T 8: 11,665,769 (GRCm39) V277E probably benign Het
Ankrd28 C T 14: 31,437,221 (GRCm39) V615I probably benign Het
Aqr G A 2: 113,945,074 (GRCm39) P1079L probably damaging Het
Brox G A 1: 183,074,068 (GRCm39) A60V probably damaging Het
Copg1 T C 6: 87,871,151 (GRCm39) V289A possibly damaging Het
Cplane1 C T 15: 8,256,551 (GRCm39) Q2004* probably null Het
Dido1 T C 2: 180,303,266 (GRCm39) N1546S probably benign Het
Dlg5 G A 14: 24,295,280 (GRCm39) P80L probably damaging Het
Dmxl1 T A 18: 49,992,337 (GRCm39) I361N probably damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fhod3 T A 18: 24,887,374 (GRCm39) D88E probably benign Het
Flywch1 A G 17: 23,974,744 (GRCm39) M632T probably benign Het
Henmt1 A G 3: 108,865,913 (GRCm39) T213A probably benign Het
Itga9 T C 9: 118,527,514 (GRCm39) V555A probably benign Het
Katnip T C 7: 125,394,422 (GRCm39) L192P probably damaging Het
Kif13b C T 14: 65,016,784 (GRCm39) R1317* probably null Het
Kndc1 A T 7: 139,475,176 (GRCm39) E25V probably damaging Het
Lingo2 T A 4: 35,708,675 (GRCm39) D435V possibly damaging Het
Lrrc14b T A 13: 74,509,283 (GRCm39) M375L probably benign Het
Lrrtm2 T C 18: 35,347,310 (GRCm39) probably null Het
Mgat4c G A 10: 102,224,931 (GRCm39) V382I probably benign Het
Muc16 T C 9: 18,478,081 (GRCm39) T7075A possibly damaging Het
Myo5b T A 18: 74,760,325 (GRCm39) probably null Het
Neb T C 2: 52,163,973 (GRCm39) D1995G possibly damaging Het
Nudt9 T C 5: 104,198,560 (GRCm39) V75A possibly damaging Het
Or4k35 C T 2: 111,100,221 (GRCm39) V164I probably benign Het
Paf1 T C 7: 28,094,493 (GRCm39) Y35H probably damaging Het
Pals2 T C 6: 50,173,603 (GRCm39) I489T probably benign Het
Panx3 T A 9: 37,572,740 (GRCm39) Q270L possibly damaging Het
Pde6h G T 6: 136,936,317 (GRCm39) R20L possibly damaging Het
Pdxk A G 10: 78,280,840 (GRCm39) I200T probably benign Het
Ppara A T 15: 85,682,392 (GRCm39) M363L probably damaging Het
Prmt8 A T 6: 127,666,846 (GRCm39) L376* probably null Het
Serpina1a G C 12: 103,820,067 (GRCm39) T393R probably damaging Het
Sfxn1 C T 13: 54,247,041 (GRCm39) R178C probably damaging Het
Sirpb1c A T 3: 15,902,559 (GRCm39) W7R possibly damaging Het
Skint5 T C 4: 113,799,857 (GRCm39) Y104C probably damaging Het
Slamf6 A T 1: 171,764,191 (GRCm39) T195S probably damaging Het
Slc2a6 T C 2: 26,914,214 (GRCm39) D301G probably benign Het
Stab2 A T 10: 86,719,646 (GRCm39) probably null Het
Tctn3 C G 19: 40,599,780 (GRCm39) D141H probably damaging Het
Tnik A G 3: 28,715,877 (GRCm39) N1164D probably damaging Het
Tpcn1 C T 5: 120,676,002 (GRCm39) V711I probably benign Het
Trim11 G A 11: 58,869,160 (GRCm39) G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 84,910,681 (GRCm39) probably null Het
Vmn1r72 T C 7: 11,403,711 (GRCm39) I246V probably benign Het
Zfp362 G T 4: 128,679,848 (GRCm39) R273S probably damaging Het
Zfp715 T C 7: 42,951,100 (GRCm39) D66G possibly damaging Het
Zftraf1 C T 15: 76,532,386 (GRCm39) D241N probably benign Het
Other mutations in Abtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Abtb2 APN 2 103,535,463 (GRCm39) missense probably benign 0.00
IGL02605:Abtb2 APN 2 103,547,602 (GRCm39) missense probably benign
IGL03161:Abtb2 APN 2 103,397,799 (GRCm39) missense probably benign 0.02
PIT4504001:Abtb2 UTSW 2 103,547,537 (GRCm39) nonsense probably null
R0147:Abtb2 UTSW 2 103,397,480 (GRCm39) missense probably benign 0.04
R1052:Abtb2 UTSW 2 103,535,417 (GRCm39) missense possibly damaging 0.46
R1419:Abtb2 UTSW 2 103,539,765 (GRCm39) missense probably benign 0.00
R1518:Abtb2 UTSW 2 103,539,629 (GRCm39) missense probably benign 0.03
R1650:Abtb2 UTSW 2 103,532,747 (GRCm39) missense probably damaging 1.00
R1795:Abtb2 UTSW 2 103,397,369 (GRCm39) missense probably benign 0.00
R2054:Abtb2 UTSW 2 103,535,462 (GRCm39) missense probably benign 0.41
R2101:Abtb2 UTSW 2 103,397,207 (GRCm39) missense probably benign 0.05
R2363:Abtb2 UTSW 2 103,397,528 (GRCm39) missense probably damaging 1.00
R3440:Abtb2 UTSW 2 103,397,577 (GRCm39) missense probably benign 0.43
R3927:Abtb2 UTSW 2 103,538,563 (GRCm39) splice site probably null
R4351:Abtb2 UTSW 2 103,513,738 (GRCm39) missense possibly damaging 0.46
R4352:Abtb2 UTSW 2 103,513,738 (GRCm39) missense possibly damaging 0.46
R4782:Abtb2 UTSW 2 103,547,644 (GRCm39) missense probably benign 0.35
R4814:Abtb2 UTSW 2 103,547,632 (GRCm39) missense probably benign 0.08
R4831:Abtb2 UTSW 2 103,513,820 (GRCm39) missense probably benign 0.06
R4900:Abtb2 UTSW 2 103,397,349 (GRCm39) missense possibly damaging 0.62
R5038:Abtb2 UTSW 2 103,397,408 (GRCm39) missense probably damaging 0.99
R5513:Abtb2 UTSW 2 103,539,623 (GRCm39) critical splice acceptor site probably null
R6119:Abtb2 UTSW 2 103,532,655 (GRCm39) missense probably benign 0.00
R6298:Abtb2 UTSW 2 103,539,833 (GRCm39) missense probably benign 0.10
R6383:Abtb2 UTSW 2 103,397,721 (GRCm39) missense probably damaging 0.98
R6860:Abtb2 UTSW 2 103,539,770 (GRCm39) nonsense probably null
R7000:Abtb2 UTSW 2 103,542,787 (GRCm39) missense possibly damaging 0.85
R7109:Abtb2 UTSW 2 103,545,860 (GRCm39) missense probably benign 0.20
R7176:Abtb2 UTSW 2 103,539,720 (GRCm39) missense probably benign 0.00
R7189:Abtb2 UTSW 2 103,397,861 (GRCm39) missense probably benign 0.00
R7199:Abtb2 UTSW 2 103,397,565 (GRCm39) missense possibly damaging 0.74
R7299:Abtb2 UTSW 2 103,532,769 (GRCm39) splice site probably null
R7347:Abtb2 UTSW 2 103,397,757 (GRCm39) missense probably damaging 1.00
R7469:Abtb2 UTSW 2 103,397,292 (GRCm39) missense probably benign 0.00
R7862:Abtb2 UTSW 2 103,532,626 (GRCm39) missense probably damaging 1.00
R8200:Abtb2 UTSW 2 103,531,162 (GRCm39) missense probably benign 0.02
R8682:Abtb2 UTSW 2 103,397,720 (GRCm39) missense probably benign 0.36
R8700:Abtb2 UTSW 2 103,397,289 (GRCm39) missense probably damaging 0.99
R9164:Abtb2 UTSW 2 103,541,829 (GRCm39) missense possibly damaging 0.50
R9196:Abtb2 UTSW 2 103,513,647 (GRCm39) missense possibly damaging 0.71
R9254:Abtb2 UTSW 2 103,541,580 (GRCm39) missense probably benign 0.00
R9258:Abtb2 UTSW 2 103,546,410 (GRCm39) missense probably null 0.99
R9343:Abtb2 UTSW 2 103,547,505 (GRCm39) missense probably benign
R9427:Abtb2 UTSW 2 103,531,244 (GRCm39) missense probably damaging 1.00
R9675:Abtb2 UTSW 2 103,538,532 (GRCm39) missense probably benign
Z1176:Abtb2 UTSW 2 103,538,517 (GRCm39) nonsense probably null
Z1177:Abtb2 UTSW 2 103,541,541 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCTGGTCTCTCGAGCCATG -3'
(R):5'- ACACATCTGCCCTGGTAAAG -3'

Sequencing Primer
(F):5'- TCTCTCGAGCCATGCACCAC -3'
(R):5'- TGCCCTGGTAAAGAAATATATTACAC -3'
Posted On 2019-10-24