Incidental Mutation 'R7629:Olfr1277'
ID 589530
Institutional Source Beutler Lab
Gene Symbol Olfr1277
Ensembl Gene ENSMUSG00000074965
Gene Name olfactory receptor 1277
Synonyms MOR248-11, GA_x6K02T2Q125-72321818-72320907
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 111264946-111274106 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 111269876 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 164 (V164I)
Ref Sequence ENSEMBL: ENSMUSP00000150703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099619] [ENSMUST00000214760]
AlphaFold Q8VF41
Predicted Effect probably benign
Transcript: ENSMUST00000099619
AA Change: V164I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097214
Gene: ENSMUSG00000074965
AA Change: V164I

DomainStartEndE-ValueType
Pfam:7tm_4 31 303 5.5e-50 PFAM
Pfam:7tm_1 41 287 7.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214760
AA Change: V164I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Olfr1277
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:Olfr1277 APN 2 111269912 missense probably damaging 1.00
IGL02550:Olfr1277 APN 2 111270004 missense probably damaging 0.99
IGL02661:Olfr1277 APN 2 111269466 missense possibly damaging 0.56
IGL02940:Olfr1277 APN 2 111269728 missense probably damaging 0.99
R0121:Olfr1277 UTSW 2 111270314 missense probably benign 0.01
R0402:Olfr1277 UTSW 2 111269863 missense probably damaging 1.00
R0903:Olfr1277 UTSW 2 111270356 missense probably benign
R1804:Olfr1277 UTSW 2 111269930 missense probably benign
R1806:Olfr1277 UTSW 2 111270277 missense possibly damaging 0.65
R1965:Olfr1277 UTSW 2 111269593 missense probably damaging 1.00
R3718:Olfr1277 UTSW 2 111270226 missense probably benign
R4044:Olfr1277 UTSW 2 111269582 missense probably benign 0.01
R4401:Olfr1277 UTSW 2 111269833 missense probably damaging 1.00
R4518:Olfr1277 UTSW 2 111269918 missense probably benign
R5309:Olfr1277 UTSW 2 111270310 missense probably benign 0.00
R5312:Olfr1277 UTSW 2 111270310 missense probably benign 0.00
R5367:Olfr1277 UTSW 2 111269890 missense possibly damaging 0.81
R5727:Olfr1277 UTSW 2 111269852 nonsense probably null
R5772:Olfr1277 UTSW 2 111269712 nonsense probably null
R5827:Olfr1277 UTSW 2 111269921 missense probably damaging 1.00
R5882:Olfr1277 UTSW 2 111270139 missense probably damaging 0.99
R6036:Olfr1277 UTSW 2 111269612 missense probably damaging 1.00
R6036:Olfr1277 UTSW 2 111269612 missense probably damaging 1.00
R6728:Olfr1277 UTSW 2 111269673 missense probably benign 0.00
R8377:Olfr1277 UTSW 2 111269638 missense probably damaging 1.00
R8870:Olfr1277 UTSW 2 111270119 missense possibly damaging 0.61
R9100:Olfr1277 UTSW 2 111269749 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AGAGCTTTGGATGCCCCATC -3'
(R):5'- AAGACGATCTCTTTTGGAGGG -3'

Sequencing Primer
(F):5'- GATGCCCCATCCTTAGAGTGAAG -3'
(R):5'- CATGTGTCAGATTTTCTTTGGACAC -3'
Posted On 2019-10-24