Incidental Mutation 'R7629:Henmt1'
ID 589535
Institutional Source Beutler Lab
Gene Symbol Henmt1
Ensembl Gene ENSMUSG00000045662
Gene Name HEN1 methyltransferase homolog 1 (Arabidopsis)
Synonyms Hen1, 4921515J06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 108939873-108960774 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108958597 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 213 (T213A)
Ref Sequence ENSEMBL: ENSMUSP00000054829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059946] [ENSMUST00000098680] [ENSMUST00000106586] [ENSMUST00000196400] [ENSMUST00000196533]
AlphaFold Q8CAE2
Predicted Effect probably benign
Transcript: ENSMUST00000059946
AA Change: T213A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054829
Gene: ENSMUSG00000045662
AA Change: T213A

DomainStartEndE-ValueType
Pfam:Methyltransf_23 32 207 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098680
AA Change: T213A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096277
Gene: ENSMUSG00000045662
AA Change: T213A

DomainStartEndE-ValueType
Pfam:Methyltransf_23 32 206 6.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106586
AA Change: T213A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102196
Gene: ENSMUSG00000045662
AA Change: T213A

DomainStartEndE-ValueType
Pfam:Methyltransf_23 32 206 1.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196400
SMART Domains Protein: ENSMUSP00000143561
Gene: ENSMUSG00000045662

DomainStartEndE-ValueType
PDB:3HTX|D 9 90 7e-7 PDB
SCOP:d1khha_ 9 90 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196533
AA Change: T170A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000143574
Gene: ENSMUSG00000045662
AA Change: T170A

DomainStartEndE-ValueType
PDB:3JWG|A 8 192 2e-34 PDB
SCOP:d1fp2a2 9 154 5e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit male infertility, pinhead sperm, decreased testis weight, ologospermia and asthenozoospermia. Female fertility is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Henmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Henmt1 APN 3 108942779 missense probably damaging 1.00
R0049:Henmt1 UTSW 3 108953789 splice site probably benign
R0143:Henmt1 UTSW 3 108953802 missense probably damaging 0.98
R0391:Henmt1 UTSW 3 108958535 splice site probably benign
R4035:Henmt1 UTSW 3 108958685 missense probably damaging 1.00
R4580:Henmt1 UTSW 3 108942765 missense probably benign 0.00
R5162:Henmt1 UTSW 3 108940050 splice site probably null
R5270:Henmt1 UTSW 3 108960214 missense probably benign 0.03
R5550:Henmt1 UTSW 3 108953868 missense probably damaging 1.00
R8341:Henmt1 UTSW 3 108958592 missense probably damaging 1.00
R8413:Henmt1 UTSW 3 108957649 missense probably damaging 1.00
R8807:Henmt1 UTSW 3 108960336 makesense probably null
X0063:Henmt1 UTSW 3 108960320 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGTGAAATATCCTGTGCATGC -3'
(R):5'- TAGAAGTTGCCCTCATCCCC -3'

Sequencing Primer
(F):5'- TGCATGCACAGGGATCTG -3'
(R):5'- ACTGTCCGTCACACTGACC -3'
Posted On 2019-10-24