Incidental Mutation 'R7629:Lingo2'
ID 589536
Institutional Source Beutler Lab
Gene Symbol Lingo2
Ensembl Gene ENSMUSG00000045083
Gene Name leucine rich repeat and Ig domain containing 2
Synonyms Lrrn6c, LERN3, B230217C06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 35706647-36951747 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 35708675 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 435 (D435V)
Ref Sequence ENSEMBL: ENSMUSP00000069772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065173] [ENSMUST00000098151] [ENSMUST00000108122] [ENSMUST00000108124] [ENSMUST00000164772]
AlphaFold Q3URE9
Predicted Effect possibly damaging
Transcript: ENSMUST00000065173
AA Change: D435V

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069772
Gene: ENSMUSG00000045083
AA Change: D435V

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098151
AA Change: D435V

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095754
Gene: ENSMUSG00000045083
AA Change: D435V

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108122
AA Change: D435V

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103757
Gene: ENSMUSG00000045083
AA Change: D435V

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108124
AA Change: D435V

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103759
Gene: ENSMUSG00000045083
AA Change: D435V

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164772
AA Change: D435V

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130423
Gene: ENSMUSG00000045083
AA Change: D435V

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Lingo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01861:Lingo2 APN 4 35709526 missense probably benign 0.31
IGL02532:Lingo2 APN 4 35709171 missense possibly damaging 0.69
IGL02999:Lingo2 APN 4 35708744 missense probably damaging 1.00
R0077:Lingo2 UTSW 4 35708375 missense possibly damaging 0.51
R0669:Lingo2 UTSW 4 35709120 missense probably benign 0.00
R1195:Lingo2 UTSW 4 35708538 missense probably damaging 1.00
R1195:Lingo2 UTSW 4 35708538 missense probably damaging 1.00
R1195:Lingo2 UTSW 4 35708538 missense probably damaging 1.00
R1403:Lingo2 UTSW 4 35709420 missense possibly damaging 0.83
R1403:Lingo2 UTSW 4 35709420 missense possibly damaging 0.83
R1552:Lingo2 UTSW 4 35708315 missense probably damaging 0.99
R2066:Lingo2 UTSW 4 35709179 missense probably benign
R4207:Lingo2 UTSW 4 35709810 missense probably benign 0.01
R4208:Lingo2 UTSW 4 35709810 missense probably benign 0.01
R4326:Lingo2 UTSW 4 35708462 missense probably damaging 1.00
R4327:Lingo2 UTSW 4 35708462 missense probably damaging 1.00
R4328:Lingo2 UTSW 4 35708462 missense probably damaging 1.00
R4474:Lingo2 UTSW 4 35708810 missense probably benign
R6801:Lingo2 UTSW 4 35709566 missense probably damaging 0.97
R7343:Lingo2 UTSW 4 35709450 missense possibly damaging 0.88
R7740:Lingo2 UTSW 4 35709248 missense probably damaging 0.98
R7867:Lingo2 UTSW 4 35709302 missense probably benign
R7995:Lingo2 UTSW 4 35709425 missense probably damaging 1.00
R8909:Lingo2 UTSW 4 35708349 missense probably damaging 0.99
R9418:Lingo2 UTSW 4 35709035 missense probably benign 0.38
Z1177:Lingo2 UTSW 4 35709656 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATCCCTTCACAGTGAGAGATGC -3'
(R):5'- CAACCCAACCTGCAGTTTG -3'

Sequencing Primer
(F):5'- CTGTGAAGGTATCGTTCCCAGC -3'
(R):5'- AACCTGCAGTTTGGGGGC -3'
Posted On 2019-10-24