Incidental Mutation 'R7629:Zfp362'
ID 589538
Institutional Source Beutler Lab
Gene Symbol Zfp362
Ensembl Gene ENSMUSG00000028799
Gene Name zinc finger protein 362
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 128773088-128806045 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 128786055 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 273 (R273S)
Ref Sequence ENSEMBL: ENSMUSP00000065733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071108] [ENSMUST00000106072] [ENSMUST00000170934]
AlphaFold B1ASA5
Predicted Effect probably damaging
Transcript: ENSMUST00000071108
AA Change: R273S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065733
Gene: ENSMUSG00000028799
AA Change: R273S

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
ZnF_C2H2 225 247 2.75e-3 SMART
ZnF_C2H2 253 275 1.98e-4 SMART
ZnF_C2H2 281 303 1.38e-3 SMART
ZnF_C2H2 309 333 3.49e-5 SMART
ZnF_C2H2 339 361 1.08e-1 SMART
ZnF_C2H2 369 391 7.26e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106072
AA Change: R273S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101686
Gene: ENSMUSG00000028799
AA Change: R273S

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
ZnF_C2H2 225 247 2.75e-3 SMART
ZnF_C2H2 253 275 1.98e-4 SMART
ZnF_C2H2 281 303 1.38e-3 SMART
ZnF_C2H2 309 333 3.49e-5 SMART
ZnF_C2H2 339 361 1.08e-1 SMART
ZnF_C2H2 369 391 7.26e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170934
AA Change: R260S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128499
Gene: ENSMUSG00000028799
AA Change: R260S

DomainStartEndE-ValueType
low complexity region 115 137 N/A INTRINSIC
low complexity region 187 198 N/A INTRINSIC
ZnF_C2H2 212 234 2.75e-3 SMART
ZnF_C2H2 240 262 1.98e-4 SMART
ZnF_C2H2 268 290 1.38e-3 SMART
ZnF_C2H2 296 320 3.49e-5 SMART
ZnF_C2H2 326 348 1.08e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Zfp362
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Zfp362 APN 4 128787109 missense probably damaging 1.00
IGL01939:Zfp362 APN 4 128787053 missense probably benign
trek UTSW 4 128785976 missense probably damaging 1.00
Zax UTSW 4 128790260 missense possibly damaging 0.71
Zebulon UTSW 4 128786015 missense probably damaging 1.00
R1471:Zfp362 UTSW 4 128787200 missense probably benign
R1892:Zfp362 UTSW 4 128790264 missense probably benign 0.17
R1901:Zfp362 UTSW 4 128790276 missense probably damaging 1.00
R2058:Zfp362 UTSW 4 128786987 missense possibly damaging 0.71
R3739:Zfp362 UTSW 4 128786889 splice site probably benign
R6772:Zfp362 UTSW 4 128790260 missense possibly damaging 0.71
R6900:Zfp362 UTSW 4 128786015 missense probably damaging 1.00
R6901:Zfp362 UTSW 4 128786015 missense probably damaging 1.00
R7105:Zfp362 UTSW 4 128774526 missense probably damaging 0.99
R7348:Zfp362 UTSW 4 128777217 missense possibly damaging 0.88
R7712:Zfp362 UTSW 4 128777410 missense probably benign 0.14
R7763:Zfp362 UTSW 4 128787031 missense probably benign
R8434:Zfp362 UTSW 4 128785976 missense probably damaging 1.00
R8508:Zfp362 UTSW 4 128774606 missense probably damaging 1.00
R9432:Zfp362 UTSW 4 128777187 missense not run
Z1177:Zfp362 UTSW 4 128774550 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTAAAAGGCCCATCAGAGG -3'
(R):5'- ATCTTCCCAGTCTTGAAGCCG -3'

Sequencing Primer
(F):5'- GTGACAGACATCCGAGAGTCC -3'
(R):5'- CGCCTCTTGCCTTATAGGTGTAAG -3'
Posted On 2019-10-24