Incidental Mutation 'R7629:Nudt9'
ID 589539
Institutional Source Beutler Lab
Gene Symbol Nudt9
Ensembl Gene ENSMUSG00000029310
Gene Name nudix (nucleoside diphosphate linked moiety X)-type motif 9
Synonyms 1190002C07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 104046306-104065379 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104050694 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 75 (V75A)
Ref Sequence ENSEMBL: ENSMUSP00000031250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031250] [ENSMUST00000128511] [ENSMUST00000134313] [ENSMUST00000148261] [ENSMUST00000150226]
AlphaFold Q8BVU5
Predicted Effect possibly damaging
Transcript: ENSMUST00000031250
AA Change: V75A

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031250
Gene: ENSMUSG00000029310
AA Change: V75A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
Pfam:NUDIX 189 334 1.2e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128511
AA Change: V25A

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119820
Gene: ENSMUSG00000029310
AA Change: V25A

DomainStartEndE-ValueType
PDB:1QVJ|A 9 158 1e-89 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000134313
AA Change: V25A

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117181
Gene: ENSMUSG00000029310
AA Change: V25A

DomainStartEndE-ValueType
PDB:1QVJ|A 9 152 2e-84 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000148261
AA Change: V25A

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115170
Gene: ENSMUSG00000029310
AA Change: V25A

DomainStartEndE-ValueType
PDB:1QVJ|A 9 110 2e-68 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000150226
AA Change: V25A

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114631
Gene: ENSMUSG00000029310
AA Change: V25A

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
Pfam:NUDIX 131 207 6.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Nudix hydrolase family. Nudix boxes are found in a family of diverse enzymes that catalyze the hydrolysis of nucleoside diphosphate derivatives. This enzyme is an ADP-ribose pyrophosphatase that catalyzes the hydrolysis of ADP-ribose to AMP and ribose-5-P. It requires divalent metal ions and an intact Nudix motif for enzymatic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Nudt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Nudt9 APN 5 104061762 unclassified probably benign
IGL01398:Nudt9 APN 5 104065113 makesense probably null
IGL01910:Nudt9 APN 5 104054309 missense probably damaging 0.96
IGL02441:Nudt9 APN 5 104065019 missense probably benign 0.01
IGL03207:Nudt9 APN 5 104058226 splice site probably benign
steady UTSW 5 104058111 missense probably damaging 1.00
streak UTSW 5 104050621 start codon destroyed possibly damaging 0.89
Struck UTSW 5 104065038 nonsense probably null
R0136:Nudt9 UTSW 5 104047106 missense probably benign
R0227:Nudt9 UTSW 5 104061675 missense possibly damaging 0.90
R0652:Nudt9 UTSW 5 104050601 missense possibly damaging 0.48
R0755:Nudt9 UTSW 5 104065054 missense probably damaging 0.98
R1156:Nudt9 UTSW 5 104050730 nonsense probably null
R1462:Nudt9 UTSW 5 104065038 nonsense probably null
R1462:Nudt9 UTSW 5 104065038 nonsense probably null
R1962:Nudt9 UTSW 5 104065105 missense probably benign
R2697:Nudt9 UTSW 5 104064993 missense probably damaging 1.00
R2916:Nudt9 UTSW 5 104055558 missense probably damaging 1.00
R3780:Nudt9 UTSW 5 104047106 missense probably benign
R3972:Nudt9 UTSW 5 104047125 missense probably benign 0.00
R4354:Nudt9 UTSW 5 104058111 missense probably damaging 1.00
R5325:Nudt9 UTSW 5 104050621 start codon destroyed possibly damaging 0.89
R5652:Nudt9 UTSW 5 104059780 missense probably benign 0.19
R6087:Nudt9 UTSW 5 104050813 missense probably benign 0.00
R6240:Nudt9 UTSW 5 104047089 missense probably benign 0.31
R6241:Nudt9 UTSW 5 104054285 missense probably damaging 0.98
R6280:Nudt9 UTSW 5 104065069 missense probably benign
R6719:Nudt9 UTSW 5 104061696 missense probably damaging 1.00
R6865:Nudt9 UTSW 5 104059679 missense probably damaging 1.00
R7225:Nudt9 UTSW 5 104065100 missense probably benign
R7685:Nudt9 UTSW 5 104047080 nonsense probably null
R8027:Nudt9 UTSW 5 104064927 splice site probably benign
R8029:Nudt9 UTSW 5 104050611 start gained probably benign
X0063:Nudt9 UTSW 5 104050694 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCAGGGTTTTGAGAGTC -3'
(R):5'- ACACCCAGCATGGATTGACG -3'

Sequencing Primer
(F):5'- AACAGCTTGCCTTAGAGGTC -3'
(R):5'- AGTCTGCTCACCTGATCT -3'
Posted On 2019-10-24