Mutagenetix > Incidental Mutations

Incidental Mutation 'R7629:Tpcn1'

589540

Institutional Source

Beutler Lab

Gene Symbol

Tpcn1

Ensembl Gene

ENSMUSG00000032741

Gene Name

two pore channel 1

Synonyms

5730403B01Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7629 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

120534153-120588673 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 120537937 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 711 (V711I)

Ref Sequence

ENSEMBL: ENSMUSP00000042188 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046426] [ENSMUST00000068326] [ENSMUST00000076051] [ENSMUST00000111889] [ENSMUST00000111890]

AlphaFold

Q9EQJ0

Predicted Effect

probably benign
Transcript: ENSMUST00000046426
AA Change: V711I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000042188
Gene: ENSMUSG00000032741
AA Change: V711I

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	106	332	1.5e-30	PFAM
Pfam:Ion_trans	441	695	1.2e-31	PFAM
SCOP:d1fxkc_	713	795	2e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000068326

SMART Domains

Protein: ENSMUSP00000064714
Gene: ENSMUSG00000032754

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Na_Ca_ex	103	246	5.7e-25	PFAM
low complexity region	262	275	N/A	INTRINSIC
low complexity region	337	351	N/A	INTRINSIC
transmembrane domain	360	382	N/A	INTRINSIC
transmembrane domain	387	409	N/A	INTRINSIC
Pfam:Na_Ca_ex	421	574	1.8e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000076051

SMART Domains

Protein: ENSMUSP00000075428
Gene: ENSMUSG00000032754

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Na_Ca_ex	113	244	9.2e-19	PFAM
low complexity region	262	275	N/A	INTRINSIC
transmembrane domain	323	345	N/A	INTRINSIC
transmembrane domain	360	382	N/A	INTRINSIC
transmembrane domain	387	409	N/A	INTRINSIC
Pfam:Na_Ca_ex	431	477	2.3e-8	PFAM
low complexity region	507	519	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111889

SMART Domains

Protein: ENSMUSP00000107520
Gene: ENSMUSG00000032754

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Na_Ca_ex	113	232	2.5e-16	PFAM
low complexity region	281	295	N/A	INTRINSIC
transmembrane domain	304	326	N/A	INTRINSIC
transmembrane domain	331	353	N/A	INTRINSIC
Pfam:Na_Ca_ex	375	516	1.7e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111890

SMART Domains

Protein: ENSMUSP00000107521
Gene: ENSMUSG00000032754

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Na_Ca_ex	116	227	2.8e-12	PFAM
low complexity region	245	258	N/A	INTRINSIC
low complexity region	320	334	N/A	INTRINSIC
transmembrane domain	343	365	N/A	INTRINSIC
transmembrane domain	370	392	N/A	INTRINSIC
Pfam:Na_Ca_ex	414	555	3.2e-27	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated Ca(2+) and Na+ channels have 4 homologous domains, each containing 6 transmembrane segments, S1 to S6. TPCN1 is similar to these channels, but it has only 2 domains containing S1 to S6 (Ishibashi et al., 2000 [PubMed 10753632]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene results in no apparent phenotypic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	G	A	16: 88,707,405	T168I	probably benign	Het
2410089E03Rik	C	T	15: 8,227,067	Q2004*	probably null	Het
Abtb2	T	A	2: 103,683,493		probably null	Het
Ankrd10	A	T	8: 11,615,769	V277E	probably benign	Het
Ankrd28	C	T	14: 31,715,264	V615I	probably benign	Het
Aqr	G	A	2: 114,114,593	P1079L	probably damaging	Het
Brox	G	A	1: 183,292,504	A60V	probably damaging	Het
Copg1	T	C	6: 87,894,169	V289A	possibly damaging	Het
Cyhr1	C	T	15: 76,648,186	D241N	probably benign	Het
D430042O09Rik	T	C	7: 125,795,250	L192P	probably damaging	Het
Dido1	T	C	2: 180,661,473	N1546S	probably benign	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dmxl1	T	A	18: 49,859,270	I361N	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fhod3	T	A	18: 24,754,317	D88E	probably benign	Het
Flywch1	A	G	17: 23,755,770	M632T	probably benign	Het
Henmt1	A	G	3: 108,958,597	T213A	probably benign	Het
Itga9	T	C	9: 118,698,446	V555A	probably benign	Het
Kif13b	C	T	14: 64,779,335	R1317*	probably null	Het
Kndc1	A	T	7: 139,895,260	E25V	probably damaging	Het
Lingo2	T	A	4: 35,708,675	D435V	possibly damaging	Het
Lrrc14b	T	A	13: 74,361,164	M375L	probably benign	Het
Lrrtm2	T	C	18: 35,214,257		probably null	Het
Mgat4c	G	A	10: 102,389,070	V382I	probably benign	Het
Mpp6	T	C	6: 50,196,623	I489T	probably benign	Het
Muc16	T	C	9: 18,566,785	T7075A	possibly damaging	Het
Myo5b	T	A	18: 74,627,254		probably null	Het
Neb	T	C	2: 52,273,961	D1995G	possibly damaging	Het
Nudt9	T	C	5: 104,050,694	V75A	possibly damaging	Het
Olfr1277	C	T	2: 111,269,876	V164I	probably benign	Het
Paf1	T	C	7: 28,395,068	Y35H	probably damaging	Het
Panx3	T	A	9: 37,661,444	Q270L	possibly damaging	Het
Pde6h	G	T	6: 136,959,319	R20L	possibly damaging	Het
Pdxk	A	G	10: 78,445,006	I200T	probably benign	Het
Ppara	A	T	15: 85,798,191	M363L	probably damaging	Het
Prmt8	A	T	6: 127,689,883	L376*	probably null	Het
Serpina1a	G	C	12: 103,853,808	T393R	probably damaging	Het
Sfxn1	C	T	13: 54,093,022	R178C	probably damaging	Het
Sirpb1c	A	T	3: 15,848,395	W7R	possibly damaging	Het
Skint5	T	C	4: 113,942,660	Y104C	probably damaging	Het
Slamf6	A	T	1: 171,936,624	T195S	probably damaging	Het
Slc2a6	T	C	2: 27,024,202	D301G	probably benign	Het
Stab2	A	T	10: 86,883,782		probably null	Het
Tctn3	C	G	19: 40,611,336	D141H	probably damaging	Het
Tnik	A	G	3: 28,661,728	N1164D	probably damaging	Het
Trim11	G	A	11: 58,978,334	G32D	probably damaging	Het
Usp32	TTTGGTTG	TTTG	11: 85,019,855		probably null	Het
Vmn1r72	T	C	7: 11,669,784	I246V	probably benign	Het
Zfp362	G	T	4: 128,786,055	R273S	probably damaging	Het
Zfp715	T	C	7: 43,301,676	D66G	possibly damaging	Het

Other mutations in Tpcn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Tpcn1	APN	5	120545305	missense	probably damaging	0.99
IGL00551:Tpcn1	APN	5	120560325	missense	probably benign	0.31
IGL02197:Tpcn1	APN	5	120553531	missense	probably damaging	1.00
IGL02584:Tpcn1	APN	5	120539032	missense	probably damaging	0.99
IGL03064:Tpcn1	APN	5	120537566	missense	possibly damaging	0.90
PIT1430001:Tpcn1	UTSW	5	120548323	splice site	probably benign
R0295:Tpcn1	UTSW	5	120539060	missense	probably damaging	1.00
R0316:Tpcn1	UTSW	5	120539259	missense	probably damaging	1.00
R1577:Tpcn1	UTSW	5	120544420	missense	probably damaging	1.00
R1660:Tpcn1	UTSW	5	120549515	missense	possibly damaging	0.82
R1819:Tpcn1	UTSW	5	120536227	splice site	probably null
R2051:Tpcn1	UTSW	5	120543388	missense	probably damaging	1.00
R2364:Tpcn1	UTSW	5	120553494	nonsense	probably null
R2497:Tpcn1	UTSW	5	120538998	splice site	probably null
R3965:Tpcn1	UTSW	5	120556575	missense	probably damaging	0.98
R3972:Tpcn1	UTSW	5	120553752	critical splice donor site	probably null
R4062:Tpcn1	UTSW	5	120557897	missense	possibly damaging	0.82
R4343:Tpcn1	UTSW	5	120560220	missense	probably damaging	1.00
R4422:Tpcn1	UTSW	5	120542518	missense	probably damaging	1.00
R4423:Tpcn1	UTSW	5	120542518	missense	probably damaging	1.00
R4424:Tpcn1	UTSW	5	120542518	missense	probably damaging	1.00
R4655:Tpcn1	UTSW	5	120539257	missense	probably damaging	0.98
R4831:Tpcn1	UTSW	5	120553489	missense	probably damaging	1.00
R4910:Tpcn1	UTSW	5	120556519	missense	probably damaging	0.98
R4948:Tpcn1	UTSW	5	120556531	missense	probably benign	0.15
R4965:Tpcn1	UTSW	5	120547487	missense	possibly damaging	0.82
R4976:Tpcn1	UTSW	5	120560322	missense	probably benign
R5071:Tpcn1	UTSW	5	120548269	critical splice donor site	probably null
R5165:Tpcn1	UTSW	5	120557945	missense	probably damaging	1.00
R5210:Tpcn1	UTSW	5	120539214	missense	probably damaging	1.00
R5910:Tpcn1	UTSW	5	120547397	intron	probably benign
R5939:Tpcn1	UTSW	5	120539827	missense	probably damaging	1.00
R6364:Tpcn1	UTSW	5	120553810	missense	probably damaging	1.00
R6633:Tpcn1	UTSW	5	120544464	missense	probably benign	0.03
R6650:Tpcn1	UTSW	5	120537562	missense	probably null	0.50
R6885:Tpcn1	UTSW	5	120544437	missense	probably benign	0.21
R7038:Tpcn1	UTSW	5	120585277	missense	probably damaging	0.99
R7247:Tpcn1	UTSW	5	120585250	missense	possibly damaging	0.63
R7594:Tpcn1	UTSW	5	120556530	missense	possibly damaging	0.67
R7854:Tpcn1	UTSW	5	120549588	missense	probably damaging	1.00
R8478:Tpcn1	UTSW	5	120560321	missense	probably benign
R8967:Tpcn1	UTSW	5	120555958	missense	probably damaging	0.98
R8970:Tpcn1	UTSW	5	120544453	missense	probably damaging	1.00
R9137:Tpcn1	UTSW	5	120557925	missense	probably damaging	1.00
R9179:Tpcn1	UTSW	5	120541950	missense	probably damaging	1.00
R9180:Tpcn1	UTSW	5	120555935	missense	probably benign	0.00
R9241:Tpcn1	UTSW	5	120553493	missense	probably benign	0.01
R9341:Tpcn1	UTSW	5	120540672	missense	possibly damaging	0.81
R9343:Tpcn1	UTSW	5	120540672	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- CCTATTGACGTTTCTGCGTG -3'
(R):5'- TGGAGACCTTCTCTTCAAGCC -3'

Sequencing Primer
(F):5'- ACCGGCTTGAAGTGGCAG -3'
(R):5'- AGATGGGTGCTCATGTAACCC -3'

Posted On

2019-10-24