Incidental Mutation 'R7629:Tpcn1'
ID 589540
Institutional Source Beutler Lab
Gene Symbol Tpcn1
Ensembl Gene ENSMUSG00000032741
Gene Name two pore channel 1
Synonyms 5730403B01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 120534153-120588673 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 120537937 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 711 (V711I)
Ref Sequence ENSEMBL: ENSMUSP00000042188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046426] [ENSMUST00000068326] [ENSMUST00000076051] [ENSMUST00000111889] [ENSMUST00000111890]
AlphaFold Q9EQJ0
Predicted Effect probably benign
Transcript: ENSMUST00000046426
AA Change: V711I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042188
Gene: ENSMUSG00000032741
AA Change: V711I

DomainStartEndE-ValueType
Pfam:Ion_trans 106 332 1.5e-30 PFAM
Pfam:Ion_trans 441 695 1.2e-31 PFAM
SCOP:d1fxkc_ 713 795 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068326
SMART Domains Protein: ENSMUSP00000064714
Gene: ENSMUSG00000032754

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 103 246 5.7e-25 PFAM
low complexity region 262 275 N/A INTRINSIC
low complexity region 337 351 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Pfam:Na_Ca_ex 421 574 1.8e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076051
SMART Domains Protein: ENSMUSP00000075428
Gene: ENSMUSG00000032754

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 113 244 9.2e-19 PFAM
low complexity region 262 275 N/A INTRINSIC
transmembrane domain 323 345 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Pfam:Na_Ca_ex 431 477 2.3e-8 PFAM
low complexity region 507 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111889
SMART Domains Protein: ENSMUSP00000107520
Gene: ENSMUSG00000032754

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 113 232 2.5e-16 PFAM
low complexity region 281 295 N/A INTRINSIC
transmembrane domain 304 326 N/A INTRINSIC
transmembrane domain 331 353 N/A INTRINSIC
Pfam:Na_Ca_ex 375 516 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111890
SMART Domains Protein: ENSMUSP00000107521
Gene: ENSMUSG00000032754

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 116 227 2.8e-12 PFAM
low complexity region 245 258 N/A INTRINSIC
low complexity region 320 334 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 370 392 N/A INTRINSIC
Pfam:Na_Ca_ex 414 555 3.2e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated Ca(2+) and Na+ channels have 4 homologous domains, each containing 6 transmembrane segments, S1 to S6. TPCN1 is similar to these channels, but it has only 2 domains containing S1 to S6 (Ishibashi et al., 2000 [PubMed 10753632]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene results in no apparent phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Tpcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Tpcn1 APN 5 120545305 missense probably damaging 0.99
IGL00551:Tpcn1 APN 5 120560325 missense probably benign 0.31
IGL02197:Tpcn1 APN 5 120553531 missense probably damaging 1.00
IGL02584:Tpcn1 APN 5 120539032 missense probably damaging 0.99
IGL03064:Tpcn1 APN 5 120537566 missense possibly damaging 0.90
PIT1430001:Tpcn1 UTSW 5 120548323 splice site probably benign
R0295:Tpcn1 UTSW 5 120539060 missense probably damaging 1.00
R0316:Tpcn1 UTSW 5 120539259 missense probably damaging 1.00
R1577:Tpcn1 UTSW 5 120544420 missense probably damaging 1.00
R1660:Tpcn1 UTSW 5 120549515 missense possibly damaging 0.82
R1819:Tpcn1 UTSW 5 120536227 splice site probably null
R2051:Tpcn1 UTSW 5 120543388 missense probably damaging 1.00
R2364:Tpcn1 UTSW 5 120553494 nonsense probably null
R2497:Tpcn1 UTSW 5 120538998 splice site probably null
R3965:Tpcn1 UTSW 5 120556575 missense probably damaging 0.98
R3972:Tpcn1 UTSW 5 120553752 critical splice donor site probably null
R4062:Tpcn1 UTSW 5 120557897 missense possibly damaging 0.82
R4343:Tpcn1 UTSW 5 120560220 missense probably damaging 1.00
R4422:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4423:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4424:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4655:Tpcn1 UTSW 5 120539257 missense probably damaging 0.98
R4831:Tpcn1 UTSW 5 120553489 missense probably damaging 1.00
R4910:Tpcn1 UTSW 5 120556519 missense probably damaging 0.98
R4948:Tpcn1 UTSW 5 120556531 missense probably benign 0.15
R4965:Tpcn1 UTSW 5 120547487 missense possibly damaging 0.82
R4976:Tpcn1 UTSW 5 120560322 missense probably benign
R5071:Tpcn1 UTSW 5 120548269 critical splice donor site probably null
R5165:Tpcn1 UTSW 5 120557945 missense probably damaging 1.00
R5210:Tpcn1 UTSW 5 120539214 missense probably damaging 1.00
R5910:Tpcn1 UTSW 5 120547397 intron probably benign
R5939:Tpcn1 UTSW 5 120539827 missense probably damaging 1.00
R6364:Tpcn1 UTSW 5 120553810 missense probably damaging 1.00
R6633:Tpcn1 UTSW 5 120544464 missense probably benign 0.03
R6650:Tpcn1 UTSW 5 120537562 missense probably null 0.50
R6885:Tpcn1 UTSW 5 120544437 missense probably benign 0.21
R7038:Tpcn1 UTSW 5 120585277 missense probably damaging 0.99
R7247:Tpcn1 UTSW 5 120585250 missense possibly damaging 0.63
R7594:Tpcn1 UTSW 5 120556530 missense possibly damaging 0.67
R7854:Tpcn1 UTSW 5 120549588 missense probably damaging 1.00
R8478:Tpcn1 UTSW 5 120560321 missense probably benign
R8967:Tpcn1 UTSW 5 120555958 missense probably damaging 0.98
R8970:Tpcn1 UTSW 5 120544453 missense probably damaging 1.00
R9137:Tpcn1 UTSW 5 120557925 missense probably damaging 1.00
R9179:Tpcn1 UTSW 5 120541950 missense probably damaging 1.00
R9180:Tpcn1 UTSW 5 120555935 missense probably benign 0.00
R9241:Tpcn1 UTSW 5 120553493 missense probably benign 0.01
R9341:Tpcn1 UTSW 5 120540672 missense possibly damaging 0.81
R9343:Tpcn1 UTSW 5 120540672 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCTATTGACGTTTCTGCGTG -3'
(R):5'- TGGAGACCTTCTCTTCAAGCC -3'

Sequencing Primer
(F):5'- ACCGGCTTGAAGTGGCAG -3'
(R):5'- AGATGGGTGCTCATGTAACCC -3'
Posted On 2019-10-24