Incidental Mutation 'R7629:Mpp6'
ID 589541
Institutional Source Beutler Lab
Gene Symbol Mpp6
Ensembl Gene ENSMUSG00000038388
Gene Name membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
Synonyms P55t, Pals2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 50110241-50198939 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 50196623 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 489 (I489T)
Ref Sequence ENSEMBL: ENSMUSP00000038772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036225] [ENSMUST00000036236] [ENSMUST00000101405] [ENSMUST00000165099] [ENSMUST00000166318] [ENSMUST00000204545]
AlphaFold Q9JLB0
Predicted Effect probably benign
Transcript: ENSMUST00000036225
AA Change: I489T

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000038772
Gene: ENSMUSG00000038388
AA Change: I489T

DomainStartEndE-ValueType
L27 1 55 1.08e-9 SMART
L27 56 110 7.05e-14 SMART
PDZ 138 208 1.45e-11 SMART
SH3 231 296 7.52e-12 SMART
GuKc 350 541 8.92e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036236
AA Change: I475T

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000039314
Gene: ENSMUSG00000038388
AA Change: I475T

DomainStartEndE-ValueType
L27 1 55 1.08e-9 SMART
L27 56 110 7.05e-14 SMART
PDZ 138 208 1.45e-11 SMART
SH3 217 282 7.52e-12 SMART
GuKc 336 527 8.92e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101405
SMART Domains Protein: ENSMUSP00000098952
Gene: ENSMUSG00000029821

DomainStartEndE-ValueType
Pfam:Gasdermin 1 399 2e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165099
SMART Domains Protein: ENSMUSP00000130522
Gene: ENSMUSG00000029821

DomainStartEndE-ValueType
Pfam:Gasdermin 1 424 1.7e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166318
AA Change: I489T

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125880
Gene: ENSMUSG00000038388
AA Change: I489T

DomainStartEndE-ValueType
L27 1 55 1.08e-9 SMART
L27 56 110 7.05e-14 SMART
PDZ 138 208 1.45e-11 SMART
SH3 231 296 7.52e-12 SMART
GuKc 350 541 8.92e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204545
AA Change: I475T

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144737
Gene: ENSMUSG00000038388
AA Change: I475T

DomainStartEndE-ValueType
L27 1 55 1.08e-9 SMART
L27 56 110 7.05e-14 SMART
PDZ 138 208 1.45e-11 SMART
SH3 217 282 7.52e-12 SMART
GuKc 336 527 8.92e-72 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the peripheral membrane-associated guanylate kinase (MAGUK) family function in tumor suppression and receptor clustering by forming multiprotein complexes containing distinct sets of transmembrane, cytoskeletal, and cytoplasmic signaling proteins. All MAGUKs contain a PDZ-SH3-GUK core and are divided into 4 subfamilies, DLG-like (see DLG1; MIM 601014), ZO1-like (see TJP1; MIM 601009), p55-like (see MPP1; MIM 305360), and LIN2-like (see CASK; MIM 300172), based on their size and the presence of additional domains. MPP6 is a member of the p55-like MAGUK subfamily (Tseng et al., 2001 [PubMed 11311936]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Mpp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Mpp6 APN 6 50196589 missense probably benign 0.26
IGL00944:Mpp6 APN 6 50163456 missense possibly damaging 0.96
IGL01576:Mpp6 APN 6 50163492 missense probably benign 0.02
IGL01639:Mpp6 APN 6 50178480 missense probably damaging 0.99
IGL02541:Mpp6 APN 6 50183727 missense probably benign 0.40
IGL02668:Mpp6 APN 6 50194529 missense probably damaging 1.00
R1033:Mpp6 UTSW 6 50183736 missense probably damaging 1.00
R1066:Mpp6 UTSW 6 50145867 missense possibly damaging 0.94
R1542:Mpp6 UTSW 6 50198326 missense probably damaging 1.00
R1799:Mpp6 UTSW 6 50196545 missense probably damaging 0.97
R1817:Mpp6 UTSW 6 50163431 missense probably benign 0.06
R1818:Mpp6 UTSW 6 50163431 missense probably benign 0.06
R4410:Mpp6 UTSW 6 50198268 nonsense probably null
R5162:Mpp6 UTSW 6 50178515 missense probably damaging 1.00
R5591:Mpp6 UTSW 6 50180179 missense probably benign 0.11
R6182:Mpp6 UTSW 6 50198226 missense probably benign
R6500:Mpp6 UTSW 6 50198166 missense possibly damaging 0.67
R6762:Mpp6 UTSW 6 50180438 splice site probably null
R6888:Mpp6 UTSW 6 50180277 critical splice donor site probably null
R6963:Mpp6 UTSW 6 50163655 splice site probably null
R7002:Mpp6 UTSW 6 50162662 missense probably benign
R8159:Mpp6 UTSW 6 50194547 missense probably benign 0.00
R9190:Mpp6 UTSW 6 50180239 missense probably damaging 1.00
R9266:Mpp6 UTSW 6 50163483 missense probably benign 0.07
X0027:Mpp6 UTSW 6 50163531 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- AAGTTATGTCCGTAAGCTCAGG -3'
(R):5'- ACAGTGTACATGCTCCAGC -3'

Sequencing Primer
(F):5'- CACAGGCACTGAAAGTGT -3'
(R):5'- CAGAGCAGTGACTTCCTA -3'
Posted On 2019-10-24