Incidental Mutation 'R7629:Copg1'
ID 589542
Institutional Source Beutler Lab
Gene Symbol Copg1
Ensembl Gene ENSMUSG00000030058
Gene Name coatomer protein complex, subunit gamma 1
Synonyms D6Ertd71e, Copg, D6Wsu16e
Accession Numbers

Genbank: NM_017477, NM_201244; MGI: 1858696

Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 87887814-87913595 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87894169 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 289 (V289A)
Ref Sequence ENSEMBL: ENSMUSP00000109237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049966] [ENSMUST00000113607]
AlphaFold Q9QZE5
Predicted Effect probably benign
Transcript: ENSMUST00000049966
SMART Domains Protein: ENSMUSP00000050858
Gene: ENSMUSG00000030058

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 109 2e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113607
AA Change: V289A

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109237
Gene: ENSMUSG00000030058
AA Change: V289A

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 539 4.1e-135 PFAM
Pfam:COP-gamma_platf 611 759 7.6e-64 PFAM
Pfam:Coatomer_g_Cpla 761 873 1.5e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI

All alleles(58) : Targeted, other(2) Gene trapped(56)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Copg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Copg1 APN 6 87902370 missense possibly damaging 0.94
IGL00816:Copg1 APN 6 87893898 missense possibly damaging 0.95
IGL02087:Copg1 APN 6 87902210 missense possibly damaging 0.68
R0194:Copg1 UTSW 6 87904197 splice site probably benign
R0448:Copg1 UTSW 6 87904926 missense probably benign
R0576:Copg1 UTSW 6 87897963 missense probably damaging 1.00
R0701:Copg1 UTSW 6 87894107 nonsense probably null
R1251:Copg1 UTSW 6 87890007 nonsense probably null
R1707:Copg1 UTSW 6 87905210 missense probably benign
R1845:Copg1 UTSW 6 87893818 missense probably damaging 1.00
R3500:Copg1 UTSW 6 87895923 splice site probably benign
R3952:Copg1 UTSW 6 87905216 missense probably benign
R4283:Copg1 UTSW 6 87908545 missense probably damaging 1.00
R4515:Copg1 UTSW 6 87907546 intron probably benign
R4715:Copg1 UTSW 6 87912286 nonsense probably null
R4797:Copg1 UTSW 6 87903468 intron probably benign
R4864:Copg1 UTSW 6 87889696 missense probably damaging 1.00
R4947:Copg1 UTSW 6 87903473 splice site probably benign
R5265:Copg1 UTSW 6 87892270 missense probably damaging 0.98
R5288:Copg1 UTSW 6 87890207 missense possibly damaging 0.90
R5386:Copg1 UTSW 6 87890207 missense possibly damaging 0.90
R5511:Copg1 UTSW 6 87912294 missense probably damaging 0.99
R5670:Copg1 UTSW 6 87912235 missense probably damaging 1.00
R5887:Copg1 UTSW 6 87902297 missense probably damaging 1.00
R7014:Copg1 UTSW 6 87902340 missense probably damaging 1.00
R7021:Copg1 UTSW 6 87894105 missense possibly damaging 0.94
R7380:Copg1 UTSW 6 87893842 missense probably damaging 0.98
R7392:Copg1 UTSW 6 87890275 missense probably benign 0.01
R7704:Copg1 UTSW 6 87907958 missense probably benign 0.13
R8060:Copg1 UTSW 6 87909721 missense probably damaging 0.96
R8184:Copg1 UTSW 6 87890014 missense probably damaging 1.00
R8683:Copg1 UTSW 6 87892655 missense probably damaging 1.00
R9320:Copg1 UTSW 6 87910090 missense possibly damaging 0.65
R9433:Copg1 UTSW 6 87903496 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTTGCCAGCTAGATGATGCC -3'
(R):5'- GAGCTTTATAGGTCCTGGGC -3'

Sequencing Primer
(F):5'- GCCAGCTAGATGATGCCTTCTG -3'
(R):5'- TTATAGGTCCTGGGCCCCAC -3'
Posted On 2019-10-24