Incidental Mutation 'R7629:Vmn1r72'
ID 589545
Institutional Source Beutler Lab
Gene Symbol Vmn1r72
Ensembl Gene ENSMUSG00000095430
Gene Name vomeronasal 1 receptor 72
Synonyms V1rg1
Accession Numbers

Genbank: NM_145843; MGI: 2182256

Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 11664479-11680147 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 11669784 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 246 (I246V)
Ref Sequence ENSEMBL: ENSMUSP00000148081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053134] [ENSMUST00000209638] [ENSMUST00000227010]
AlphaFold Q8K3N7
Predicted Effect probably benign
Transcript: ENSMUST00000053134
AA Change: I246V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052997
Gene: ENSMUSG00000095430
AA Change: I246V

DomainStartEndE-ValueType
Pfam:TAS2R 1 305 1.8e-9 PFAM
Pfam:V1R 25 300 6.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209638
AA Change: I246V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227010
AA Change: I246V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Vmn1r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Vmn1r72 APN 7 11670497 missense probably benign 0.41
IGL02375:Vmn1r72 APN 7 11669745 missense probably benign 0.10
IGL02809:Vmn1r72 APN 7 11670003 missense probably benign 0.03
IGL03104:Vmn1r72 APN 7 11669885 missense probably damaging 1.00
3-1:Vmn1r72 UTSW 7 11669898 missense probably damaging 0.97
IGL03014:Vmn1r72 UTSW 7 11669784 missense possibly damaging 0.80
R0346:Vmn1r72 UTSW 7 11669694 missense probably benign
R0524:Vmn1r72 UTSW 7 11669792 missense probably benign 0.32
R1951:Vmn1r72 UTSW 7 11669804 missense probably damaging 1.00
R1953:Vmn1r72 UTSW 7 11669804 missense probably damaging 1.00
R2181:Vmn1r72 UTSW 7 11669668 nonsense probably null
R4182:Vmn1r72 UTSW 7 11670068 missense probably benign 0.00
R4345:Vmn1r72 UTSW 7 11670036 missense possibly damaging 0.86
R4496:Vmn1r72 UTSW 7 11669864 missense probably damaging 1.00
R4999:Vmn1r72 UTSW 7 11670373 missense possibly damaging 0.63
R5401:Vmn1r72 UTSW 7 11669916 missense probably damaging 1.00
R5700:Vmn1r72 UTSW 7 11670423 missense probably damaging 0.98
R5754:Vmn1r72 UTSW 7 11669849 missense probably damaging 0.99
R6292:Vmn1r72 UTSW 7 11669652 missense probably benign 0.02
R6439:Vmn1r72 UTSW 7 11679137 splice site probably null
R7616:Vmn1r72 UTSW 7 11670345 missense probably damaging 0.96
R7737:Vmn1r72 UTSW 7 11669707 missense probably damaging 0.98
R7819:Vmn1r72 UTSW 7 11669625 missense probably benign 0.01
R8358:Vmn1r72 UTSW 7 11670383 missense probably damaging 0.99
R8797:Vmn1r72 UTSW 7 11670038 missense probably benign
R8848:Vmn1r72 UTSW 7 11670342 missense probably damaging 0.98
R8947:Vmn1r72 UTSW 7 11669880 missense possibly damaging 0.89
R9010:Vmn1r72 UTSW 7 11670218 missense possibly damaging 0.89
R9165:Vmn1r72 UTSW 7 11679024 intron probably benign
X0063:Vmn1r72 UTSW 7 11669712 missense probably benign 0.00
Z1088:Vmn1r72 UTSW 7 11670173 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACATCCGCTCTGTGTGTATGTG -3'
(R):5'- ATGCTTCTCTGATGGACTGTGC -3'

Sequencing Primer
(F):5'- TGACAAACTTGGAGGAAGCTATCTC -3'
(R):5'- CTTGGGTCTCATGGCCTGC -3'
Posted On 2019-10-24