Incidental Mutation 'R7629:Paf1'
ID 589546
Institutional Source Beutler Lab
Gene Symbol Paf1
Ensembl Gene ENSMUSG00000003437
Gene Name Paf1, RNA polymerase II complex component
Synonyms 5730511K23Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 28392951-28399388 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28395068 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 35 (Y35H)
Ref Sequence ENSEMBL: ENSMUSP00000003529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003529] [ENSMUST00000003536] [ENSMUST00000040531] [ENSMUST00000208199]
AlphaFold Q8K2T8
Predicted Effect probably damaging
Transcript: ENSMUST00000003529
AA Change: Y35H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003529
Gene: ENSMUSG00000003437
AA Change: Y35H

DomainStartEndE-ValueType
Pfam:Paf1 28 441 2.3e-154 PFAM
low complexity region 456 470 N/A INTRINSIC
low complexity region 476 511 N/A INTRINSIC
low complexity region 514 535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000003536
SMART Domains Protein: ENSMUSP00000003536
Gene: ENSMUSG00000003444

DomainStartEndE-ValueType
Pfam:Med29 51 186 7.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040531
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208199
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the polymerase associated factor (PAF1) complex. The PAF1 complex interacts with RNA polymerase II and plays a role in transcription elongation as well as histone modifications including ubiquitylation and methylation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Paf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Paf1 APN 7 28398690 unclassified probably benign
IGL02583:Paf1 APN 7 28396171 missense probably damaging 0.98
IGL02965:Paf1 APN 7 28396204 critical splice donor site probably null
IGL03117:Paf1 APN 7 28395056 missense possibly damaging 0.92
K3955:Paf1 UTSW 7 28396925 splice site probably null
P0038:Paf1 UTSW 7 28396925 splice site probably null
R0445:Paf1 UTSW 7 28395688 missense probably damaging 1.00
R1389:Paf1 UTSW 7 28398832 unclassified probably benign
R1808:Paf1 UTSW 7 28396822 missense probably damaging 1.00
R2006:Paf1 UTSW 7 28395768 splice site probably null
R5213:Paf1 UTSW 7 28395972 missense possibly damaging 0.71
R5413:Paf1 UTSW 7 28396615 missense possibly damaging 0.82
R5419:Paf1 UTSW 7 28395670 missense possibly damaging 0.68
R5795:Paf1 UTSW 7 28396618 missense probably damaging 0.97
R7378:Paf1 UTSW 7 28396928 missense probably damaging 1.00
R7502:Paf1 UTSW 7 28395868 missense possibly damaging 0.91
R7896:Paf1 UTSW 7 28396647 missense probably damaging 1.00
R9013:Paf1 UTSW 7 28398708 missense unknown
R9430:Paf1 UTSW 7 28396906 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GTCAGGTTCCCCTTGTTACAG -3'
(R):5'- AGTAAGAAGGGTATTGCATACTGC -3'

Sequencing Primer
(F):5'- ACAGGTGGTTGTCAGCAG -3'
(R):5'- AGTAGTTACTGAGCACCTCCTATGTG -3'
Posted On 2019-10-24