Incidental Mutation 'R7629:Zfp715'
ID589547
Institutional Source Beutler Lab
Gene Symbol Zfp715
Ensembl Gene ENSMUSG00000012640
Gene Namezinc finger protein 715
Synonymsmszf15, 2610041B18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7629 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location43296197-43313294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43301676 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 66 (D66G)
Ref Sequence ENSEMBL: ENSMUSP00000040282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012796] [ENSMUST00000048015] [ENSMUST00000107986] [ENSMUST00000135130] [ENSMUST00000139061] [ENSMUST00000145622]
Predicted Effect possibly damaging
Transcript: ENSMUST00000012796
AA Change: D66G

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000012796
Gene: ENSMUSG00000012640
AA Change: D66G

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 124 146 3.39e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000048015
AA Change: D66G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040282
Gene: ENSMUSG00000012640
AA Change: D66G

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107986
AA Change: D66G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103620
Gene: ENSMUSG00000012640
AA Change: D66G

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135130
AA Change: D66G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122812
Gene: ENSMUSG00000012640
AA Change: D66G

DomainStartEndE-ValueType
KRAB 48 88 5.49e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000139061
AA Change: D66G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114600
Gene: ENSMUSG00000012640
AA Change: D66G

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145622
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Other mutations in Zfp715
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Zfp715 APN 7 43299749 missense possibly damaging 0.53
IGL00984:Zfp715 APN 7 43299784 missense probably benign 0.28
IGL03401:Zfp715 APN 7 43299736 missense probably benign 0.18
R0373:Zfp715 UTSW 7 43299336 missense possibly damaging 0.96
R1167:Zfp715 UTSW 7 43298437 missense possibly damaging 0.83
R1943:Zfp715 UTSW 7 43299630 missense possibly damaging 0.86
R1987:Zfp715 UTSW 7 43298649 missense possibly damaging 0.71
R2073:Zfp715 UTSW 7 43311120 missense probably benign 0.01
R2116:Zfp715 UTSW 7 43297946 missense possibly damaging 0.71
R2403:Zfp715 UTSW 7 43299268 missense possibly damaging 0.91
R3707:Zfp715 UTSW 7 43311129 missense probably benign
R3838:Zfp715 UTSW 7 43299756 missense probably benign 0.33
R4059:Zfp715 UTSW 7 43301731 missense probably benign 0.11
R4110:Zfp715 UTSW 7 43297880 missense possibly damaging 0.72
R4426:Zfp715 UTSW 7 43311092 missense probably damaging 0.99
R4675:Zfp715 UTSW 7 43300020 missense probably benign 0.15
R4898:Zfp715 UTSW 7 43299682 missense possibly damaging 0.48
R5007:Zfp715 UTSW 7 43299595 missense possibly damaging 0.53
R5477:Zfp715 UTSW 7 43299954 missense probably damaging 0.99
R5574:Zfp715 UTSW 7 43311039 missense possibly damaging 0.94
R5594:Zfp715 UTSW 7 43299692 missense possibly damaging 0.73
R5967:Zfp715 UTSW 7 43299148 missense probably benign 0.04
R6538:Zfp715 UTSW 7 43299149 missense possibly damaging 0.73
R7322:Zfp715 UTSW 7 43311138 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGAGACTGACAGAGATTACACTTCTG -3'
(R):5'- GGATTGGTTCCTTTATAAGCATTCTC -3'

Sequencing Primer
(F):5'- CTGATACCTCACTATGCTTTGGAAAG -3'
(R):5'- GCATTCTCTATCTCCCCAAATTAATG -3'
Posted On2019-10-24