Incidental Mutation 'R7629:Fan1'
ID 589548
Institutional Source Beutler Lab
Gene Symbol Fan1
Ensembl Gene ENSMUSG00000033458
Gene Name FANCD2/FANCI-associated nuclease 1
Synonyms Mtmr15
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 64346758-64374095 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 64372486 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 340 (N340Y)
Ref Sequence ENSEMBL: ENSMUSP00000130012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032735] [ENSMUST00000163289]
AlphaFold Q69ZT1
Predicted Effect probably benign
Transcript: ENSMUST00000032735
SMART Domains Protein: ENSMUSP00000032735
Gene: ENSMUSG00000030521

DomainStartEndE-ValueType
Pfam:Mpp10 20 654 6.9e-217 PFAM
low complexity region 666 671 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163289
AA Change: N340Y

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130012
Gene: ENSMUSG00000033458
AA Change: N340Y

DomainStartEndE-ValueType
SCOP:d1ihga1 600 737 5e-5 SMART
Blast:VRR_NUC 834 867 2e-12 BLAST
VRR_NUC 896 1011 1.99e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206778
Meta Mutation Damage Score 0.1011 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene plays a role in DNA interstrand cross-link repair and encodes a protein with 5' flap endonuclease and 5'-3' exonuclease activity. Mutations in this gene cause karyomegalic interstitial nephritis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for mutations in this gene display renal tubular karyomegaly with polyploidy and defects in interstrand cross-link DNA repair. Some homozygous mice also display hepatocyte karyomegaly and liver dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Fan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Fan1 APN 7 64372549 missense probably damaging 0.96
IGL01752:Fan1 APN 7 64372794 missense probably benign 0.00
IGL01971:Fan1 APN 7 64353711 missense probably damaging 0.98
IGL02043:Fan1 APN 7 64371619 splice site probably null
IGL02542:Fan1 APN 7 64364660 missense probably damaging 1.00
IGL02731:Fan1 APN 7 64372993 missense possibly damaging 0.86
IGL03111:Fan1 APN 7 64350068 missense possibly damaging 0.67
hitched UTSW 7 64364629 missense probably damaging 1.00
stitched UTSW 7 64372486 missense probably damaging 0.97
R0270:Fan1 UTSW 7 64348871 missense probably benign 0.26
R0632:Fan1 UTSW 7 64363199 missense possibly damaging 0.50
R1714:Fan1 UTSW 7 64366687 missense probably benign 0.29
R1750:Fan1 UTSW 7 64373013 missense probably benign 0.14
R1822:Fan1 UTSW 7 64372806 missense probably benign 0.00
R2031:Fan1 UTSW 7 64354424 missense probably damaging 0.98
R2107:Fan1 UTSW 7 64366788 missense probably damaging 1.00
R2126:Fan1 UTSW 7 64346888 missense probably damaging 1.00
R2869:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2869:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2870:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2870:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2871:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2871:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2873:Fan1 UTSW 7 64363190 missense probably benign 0.16
R3849:Fan1 UTSW 7 64372371 missense probably damaging 1.00
R3850:Fan1 UTSW 7 64372371 missense probably damaging 1.00
R3949:Fan1 UTSW 7 64371544 nonsense probably null
R4007:Fan1 UTSW 7 64366561 missense probably damaging 1.00
R4490:Fan1 UTSW 7 64369180 missense possibly damaging 0.84
R4623:Fan1 UTSW 7 64373553 nonsense probably null
R4918:Fan1 UTSW 7 64373538 utr 5 prime probably benign
R5328:Fan1 UTSW 7 64354469 missense probably damaging 1.00
R5691:Fan1 UTSW 7 64354370 splice site probably null
R5902:Fan1 UTSW 7 64373322 splice site probably null
R5905:Fan1 UTSW 7 64353651 missense probably benign 0.00
R6126:Fan1 UTSW 7 64364570 nonsense probably null
R6195:Fan1 UTSW 7 64354371 missense probably damaging 1.00
R6233:Fan1 UTSW 7 64354371 missense probably damaging 1.00
R6405:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6434:Fan1 UTSW 7 64354381 missense probably damaging 0.99
R6460:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6469:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6471:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6473:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6696:Fan1 UTSW 7 64350078 missense probably damaging 1.00
R6708:Fan1 UTSW 7 64372806 missense probably benign 0.00
R6713:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6714:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6749:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6841:Fan1 UTSW 7 64364629 missense probably damaging 1.00
R6858:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6859:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6860:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6925:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6927:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6936:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6938:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6939:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7040:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7120:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7290:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7292:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7459:Fan1 UTSW 7 64348966 missense probably damaging 0.99
R7460:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7464:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7465:Fan1 UTSW 7 64353638 missense probably benign 0.30
R7465:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7608:Fan1 UTSW 7 64354231 splice site probably null
R7624:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7682:Fan1 UTSW 7 64372764 missense probably benign 0.06
R7731:Fan1 UTSW 7 64372696 missense probably benign 0.17
R7863:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8054:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8055:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8057:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8058:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8101:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8241:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8262:Fan1 UTSW 7 64373306 missense probably benign 0.02
R8274:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8275:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8276:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8285:Fan1 UTSW 7 64366600 missense probably damaging 0.96
R8318:Fan1 UTSW 7 64350055 missense probably damaging 1.00
R8402:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8466:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8468:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8799:Fan1 UTSW 7 64366658 missense probably damaging 0.99
R8821:Fan1 UTSW 7 64354501 missense probably damaging 1.00
R9030:Fan1 UTSW 7 64373013 missense probably benign 0.14
R9181:Fan1 UTSW 7 64366652 missense probably damaging 0.98
X0025:Fan1 UTSW 7 64372835 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTTCTCCTGCTCATCGAAGAG -3'
(R):5'- GTAACACGAAATCCTCTCCGGG -3'

Sequencing Primer
(F):5'- TCATCGAAGAGCTTCATGTCC -3'
(R):5'- TCTCCGGGAGACACTCTTGTAAAG -3'
Posted On 2019-10-24