Mutagenetix > Incidental Mutations

Incidental Mutation 'R7629:Itga9'

589554

Institutional Source

Beutler Lab

Gene Symbol

Itga9

Ensembl Gene

ENSMUSG00000039115

Gene Name

integrin alpha 9

Synonyms

D9Ertd428e, 2610002H11Rik, 6720458D17Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7629 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118606690-118901003 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118698446 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 555 (V555A)

Ref Sequence

ENSEMBL: ENSMUSP00000044227 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044165]

AlphaFold

B8JK39

Predicted Effect

probably benign
Transcript: ENSMUST00000044165
AA Change: V555A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000044227
Gene: ENSMUSG00000039115
AA Change: V555A

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	105	8.95e-7	SMART
low complexity region	181	191	N/A	INTRINSIC
Int_alpha	244	297	2.12e-8	SMART
Int_alpha	301	356	1.68e-11	SMART
Int_alpha	361	416	2.9e-15	SMART
Int_alpha	423	476	1.11e-2	SMART
SCOP:d1m1xa2	626	766	3e-32	SMART
SCOP:d1m1xa3	769	970	1e-39	SMART
transmembrane domain	981	1003	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane glycoproteins composed of an alpha chain and a beta chain that mediate cell-cell and cell-matrix adhesion. The protein encoded by this gene, when bound to the beta 1 chain, forms an integrin that is a receptor for VCAM1, cytotactin and osteopontin. Expression of this gene has been found to be upregulated in small cell lung cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in respiratory distress leading to postnatal lethality caused by an accumulation of pleural fluid rich in triglyceride, cholesterol and lymphocytes. Mice develop edema and lymphocytic infiltration in the chest wall. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	G	A	16: 88,707,405	T168I	probably benign	Het
2410089E03Rik	C	T	15: 8,227,067	Q2004*	probably null	Het
Abtb2	T	A	2: 103,683,493		probably null	Het
Ankrd10	A	T	8: 11,615,769	V277E	probably benign	Het
Ankrd28	C	T	14: 31,715,264	V615I	probably benign	Het
Aqr	G	A	2: 114,114,593	P1079L	probably damaging	Het
Brox	G	A	1: 183,292,504	A60V	probably damaging	Het
Copg1	T	C	6: 87,894,169	V289A	possibly damaging	Het
Cyhr1	C	T	15: 76,648,186	D241N	probably benign	Het
D430042O09Rik	T	C	7: 125,795,250	L192P	probably damaging	Het
Dido1	T	C	2: 180,661,473	N1546S	probably benign	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dmxl1	T	A	18: 49,859,270	I361N	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fhod3	T	A	18: 24,754,317	D88E	probably benign	Het
Flywch1	A	G	17: 23,755,770	M632T	probably benign	Het
Henmt1	A	G	3: 108,958,597	T213A	probably benign	Het
Kif13b	C	T	14: 64,779,335	R1317*	probably null	Het
Kndc1	A	T	7: 139,895,260	E25V	probably damaging	Het
Lingo2	T	A	4: 35,708,675	D435V	possibly damaging	Het
Lrrc14b	T	A	13: 74,361,164	M375L	probably benign	Het
Lrrtm2	T	C	18: 35,214,257		probably null	Het
Mgat4c	G	A	10: 102,389,070	V382I	probably benign	Het
Mpp6	T	C	6: 50,196,623	I489T	probably benign	Het
Muc16	T	C	9: 18,566,785	T7075A	possibly damaging	Het
Myo5b	T	A	18: 74,627,254		probably null	Het
Neb	T	C	2: 52,273,961	D1995G	possibly damaging	Het
Nudt9	T	C	5: 104,050,694	V75A	possibly damaging	Het
Olfr1277	C	T	2: 111,269,876	V164I	probably benign	Het
Paf1	T	C	7: 28,395,068	Y35H	probably damaging	Het
Panx3	T	A	9: 37,661,444	Q270L	possibly damaging	Het
Pde6h	G	T	6: 136,959,319	R20L	possibly damaging	Het
Pdxk	A	G	10: 78,445,006	I200T	probably benign	Het
Ppara	A	T	15: 85,798,191	M363L	probably damaging	Het
Prmt8	A	T	6: 127,689,883	L376*	probably null	Het
Serpina1a	G	C	12: 103,853,808	T393R	probably damaging	Het
Sfxn1	C	T	13: 54,093,022	R178C	probably damaging	Het
Sirpb1c	A	T	3: 15,848,395	W7R	possibly damaging	Het
Skint5	T	C	4: 113,942,660	Y104C	probably damaging	Het
Slamf6	A	T	1: 171,936,624	T195S	probably damaging	Het
Slc2a6	T	C	2: 27,024,202	D301G	probably benign	Het
Stab2	A	T	10: 86,883,782		probably null	Het
Tctn3	C	G	19: 40,611,336	D141H	probably damaging	Het
Tnik	A	G	3: 28,661,728	N1164D	probably damaging	Het
Tpcn1	C	T	5: 120,537,937	V711I	probably benign	Het
Trim11	G	A	11: 58,978,334	G32D	probably damaging	Het
Usp32	TTTGGTTG	TTTG	11: 85,019,855		probably null	Het
Vmn1r72	T	C	7: 11,669,784	I246V	probably benign	Het
Zfp362	G	T	4: 128,786,055	R273S	probably damaging	Het
Zfp715	T	C	7: 43,301,676	D66G	possibly damaging	Het

Other mutations in Itga9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Itga9	APN	9	118769159	start codon destroyed	probably null	0.02
IGL01396:Itga9	APN	9	118607123	splice site	probably benign
IGL01476:Itga9	APN	9	118607111	missense	probably damaging	1.00
IGL01573:Itga9	APN	9	118877230	splice site	probably benign
IGL01958:Itga9	APN	9	118636494	splice site	probably benign
IGL02060:Itga9	APN	9	118661432	missense	probably damaging	1.00
IGL02146:Itga9	APN	9	118834332	missense	possibly damaging	0.50
IGL02391:Itga9	APN	9	118850805	missense	probably benign	0.19
IGL02947:Itga9	APN	9	118658533	missense	probably damaging	1.00
IGL03014:Itga9	UTSW	9	118628144	missense	probably benign
R0052:Itga9	UTSW	9	118636549	missense	probably damaging	1.00
R0052:Itga9	UTSW	9	118636549	missense	probably damaging	1.00
R0142:Itga9	UTSW	9	118636586	missense	probably damaging	0.96
R0179:Itga9	UTSW	9	118661386	missense	probably benign	0.11
R0207:Itga9	UTSW	9	118769253	splice site	probably benign
R0364:Itga9	UTSW	9	118841142	missense	probably benign
R0458:Itga9	UTSW	9	118681028	critical splice donor site	probably null
R1486:Itga9	UTSW	9	118626450	missense	probably damaging	0.98
R1589:Itga9	UTSW	9	118607117	critical splice donor site	probably null
R1620:Itga9	UTSW	9	118843502	missense	probably benign	0.00
R1711:Itga9	UTSW	9	118698461	missense	probably benign	0.00
R1721:Itga9	UTSW	9	118698306	splice site	probably benign
R2064:Itga9	UTSW	9	118807293	missense	probably damaging	0.99
R2201:Itga9	UTSW	9	118877115	splice site	probably benign
R2851:Itga9	UTSW	9	118636536	missense	probably damaging	0.98
R2853:Itga9	UTSW	9	118636536	missense	probably damaging	0.98
R3962:Itga9	UTSW	9	118628186	missense	possibly damaging	0.57
R4180:Itga9	UTSW	9	118607078	missense	probably damaging	1.00
R4597:Itga9	UTSW	9	118843514	missense	probably damaging	1.00
R4716:Itga9	UTSW	9	118681758	missense	probably damaging	0.98
R4929:Itga9	UTSW	9	118807249	missense	probably damaging	1.00
R5002:Itga9	UTSW	9	118663898	nonsense	probably null
R5279:Itga9	UTSW	9	118628205	missense	probably damaging	1.00
R5542:Itga9	UTSW	9	118843661	missense	possibly damaging	0.86
R5869:Itga9	UTSW	9	118663889	missense	probably damaging	1.00
R6372:Itga9	UTSW	9	118897321	missense	probably damaging	1.00
R6470:Itga9	UTSW	9	118897267	missense	probably damaging	0.99
R6581:Itga9	UTSW	9	118658564	missense	probably benign	0.00
R6919:Itga9	UTSW	9	118887815	missense	probably damaging	1.00
R7034:Itga9	UTSW	9	118698365	missense	probably benign	0.00
R7036:Itga9	UTSW	9	118698365	missense	probably benign	0.00
R7043:Itga9	UTSW	9	118769116	missense	probably damaging	0.96
R7237:Itga9	UTSW	9	118636602	missense	probably benign	0.09
R7491:Itga9	UTSW	9	118769111	missense	probably damaging	0.99
R7774:Itga9	UTSW	9	118871900	missense	probably damaging	1.00
R7782:Itga9	UTSW	9	118843644	missense
R7789:Itga9	UTSW	9	118658496	missense	possibly damaging	0.80
R7904:Itga9	UTSW	9	118877226	splice site	probably null
R8086:Itga9	UTSW	9	118850801	missense	probably benign
R8158:Itga9	UTSW	9	118877143	missense	probably damaging	0.99
R8204:Itga9	UTSW	9	118871921	missense	probably damaging	1.00
R8895:Itga9	UTSW	9	118681767	missense	probably damaging	1.00
R9074:Itga9	UTSW	9	118807276	missense	probably damaging	1.00
R9090:Itga9	UTSW	9	118671791	missense	possibly damaging	0.93
R9271:Itga9	UTSW	9	118671791	missense	possibly damaging	0.93
R9318:Itga9	UTSW	9	118626468	missense	probably benign	0.03
R9434:Itga9	UTSW	9	118807247	missense	probably damaging	1.00
Z1176:Itga9	UTSW	9	118843530	missense	probably benign	0.00
Z1176:Itga9	UTSW	9	118887839	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATAGGGTCTCCACAGAAC -3'
(R):5'- CGCAACAGTGTTTCCAAACG -3'

Sequencing Primer
(F):5'- GGGCTCAGAGTCTCAACACTC -3'
(R):5'- CAGTGTTTCCAAACGGAATTAAAC -3'

Posted On

2019-10-24