Incidental Mutation 'R7629:Pdxk'
ID 589555
Institutional Source Beutler Lab
Gene Symbol Pdxk
Ensembl Gene ENSMUSG00000032788
Gene Name pyridoxal (pyridoxine, vitamin B6) kinase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 78436744-78464975 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78445006 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 200 (I200T)
Ref Sequence ENSEMBL: ENSMUSP00000038540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041616]
AlphaFold Q8K183
Predicted Effect probably benign
Transcript: ENSMUST00000041616
AA Change: I200T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038540
Gene: ENSMUSG00000032788
AA Change: I200T

DomainStartEndE-ValueType
Pfam:Phos_pyr_kin 69 285 1.4e-18 PFAM
Pfam:PfkB 95 277 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene phosphorylates vitamin B6, a step required for the conversion of vitamin B6 to pyridoxal-5-phosphate, an important cofactor in intermediary metabolism. The encoded protein is cytoplasmic and probably acts as a homodimer. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Pdxk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02556:Pdxk APN 10 78451485 missense probably damaging 1.00
R1434:Pdxk UTSW 10 78440811 missense probably benign 0.01
R1572:Pdxk UTSW 10 78447980 missense probably damaging 1.00
R1719:Pdxk UTSW 10 78443896 missense probably benign
R1970:Pdxk UTSW 10 78441154 missense probably damaging 1.00
R2962:Pdxk UTSW 10 78443833 missense probably damaging 1.00
R4094:Pdxk UTSW 10 78464810 missense probably damaging 1.00
R4095:Pdxk UTSW 10 78464810 missense probably damaging 1.00
R4613:Pdxk UTSW 10 78447919 missense probably damaging 0.99
R4686:Pdxk UTSW 10 78447003 splice site probably null
R4783:Pdxk UTSW 10 78464792 missense possibly damaging 0.72
R4980:Pdxk UTSW 10 78451484 missense probably damaging 1.00
R5076:Pdxk UTSW 10 78450307 missense probably benign
R5847:Pdxk UTSW 10 78445038 missense probably benign
R6145:Pdxk UTSW 10 78443791 missense probably benign 0.44
R7109:Pdxk UTSW 10 78446976 missense probably damaging 1.00
R7399:Pdxk UTSW 10 78440863 missense probably benign 0.00
R7445:Pdxk UTSW 10 78447967 missense probably benign
R7700:Pdxk UTSW 10 78443930 splice site probably null
R7936:Pdxk UTSW 10 78441178 missense possibly damaging 0.93
R8178:Pdxk UTSW 10 78453504 missense probably damaging 0.99
R8780:Pdxk UTSW 10 78447952 missense probably benign 0.04
R8783:Pdxk UTSW 10 78451505 missense probably benign 0.06
R8964:Pdxk UTSW 10 78447937 missense probably benign 0.17
Z1176:Pdxk UTSW 10 78441188 missense probably damaging 1.00
Z1177:Pdxk UTSW 10 78443905 missense probably benign 0.33
Z1189:Pdxk UTSW 10 78445061 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TGAGTCTGCTTATGTCCCCAG -3'
(R):5'- TGCAGAGAGGACAGTGACCTAC -3'

Sequencing Primer
(F):5'- TGTCTGACTCTCCTGGGGGAC -3'
(R):5'- ACAGTGACCTACAGGGGC -3'
Posted On 2019-10-24