Incidental Mutation 'R7629:Mgat4c'
ID589557
Institutional Source Beutler Lab
Gene Symbol Mgat4c
Ensembl Gene ENSMUSG00000019888
Gene NameMGAT4 family, member C
Synonyms9130411I17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7629 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location101681487-102391469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102389070 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 382 (V382I)
Ref Sequence ENSEMBL: ENSMUSP00000020039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020039] [ENSMUST00000120748] [ENSMUST00000127504] [ENSMUST00000138522] [ENSMUST00000156751] [ENSMUST00000163753] [ENSMUST00000179929] [ENSMUST00000219195]
Predicted Effect probably benign
Transcript: ENSMUST00000020039
AA Change: V382I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020039
Gene: ENSMUSG00000019888
AA Change: V382I

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 44 330 5.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120748
AA Change: V382I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114010
Gene: ENSMUSG00000019888
AA Change: V382I

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 44 330 5.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127504
SMART Domains Protein: ENSMUSP00000117148
Gene: ENSMUSG00000019888

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138522
SMART Domains Protein: ENSMUSP00000118056
Gene: ENSMUSG00000019888

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
Pfam:Glyco_transf_54 43 150 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156751
SMART Domains Protein: ENSMUSP00000116216
Gene: ENSMUSG00000019888

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163753
AA Change: V382I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000131551
Gene: ENSMUSG00000019888
AA Change: V382I

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 44 330 5.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179929
AA Change: V382I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000135959
Gene: ENSMUSG00000019888
AA Change: V382I

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 52 330 1.1e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219195
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Mgat4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mgat4c APN 10 102388720 missense probably damaging 1.00
IGL01293:Mgat4c APN 10 102388225 missense probably benign 0.00
IGL01394:Mgat4c APN 10 102385114 missense possibly damaging 0.62
IGL01525:Mgat4c APN 10 102378196 missense probably damaging 0.97
IGL02023:Mgat4c APN 10 102378184 nonsense probably null
IGL02150:Mgat4c APN 10 102389122 missense probably benign 0.08
IGL02296:Mgat4c APN 10 102385160 splice site probably benign
IGL02946:Mgat4c APN 10 102389253 missense probably benign 0.14
IGL03062:Mgat4c APN 10 102388461 missense probably damaging 1.00
R0001:Mgat4c UTSW 10 102388956 missense probably benign 0.01
R0326:Mgat4c UTSW 10 102388704 missense probably damaging 1.00
R0480:Mgat4c UTSW 10 102389119 missense probably damaging 0.97
R0656:Mgat4c UTSW 10 102388591 missense probably damaging 1.00
R0746:Mgat4c UTSW 10 102388687 missense probably damaging 1.00
R1639:Mgat4c UTSW 10 102378281 missense probably damaging 1.00
R1989:Mgat4c UTSW 10 102378159 start codon destroyed probably null 0.66
R2148:Mgat4c UTSW 10 102388929 missense probably benign
R2437:Mgat4c UTSW 10 102388575 missense probably damaging 1.00
R2567:Mgat4c UTSW 10 102378262 missense probably benign 0.38
R3780:Mgat4c UTSW 10 102388921 missense probably benign 0.25
R3781:Mgat4c UTSW 10 102388921 missense probably benign 0.25
R3782:Mgat4c UTSW 10 102388921 missense probably benign 0.25
R3786:Mgat4c UTSW 10 102385070 missense probably damaging 1.00
R3806:Mgat4c UTSW 10 102388360 missense probably benign 0.10
R4596:Mgat4c UTSW 10 102388561 missense probably damaging 1.00
R4718:Mgat4c UTSW 10 102388606 missense probably damaging 1.00
R4740:Mgat4c UTSW 10 102388404 missense probably damaging 1.00
R4872:Mgat4c UTSW 10 102388738 missense probably damaging 1.00
R5305:Mgat4c UTSW 10 102389279 missense possibly damaging 0.82
R5740:Mgat4c UTSW 10 102389321 missense possibly damaging 0.49
R5841:Mgat4c UTSW 10 102388965 missense probably damaging 0.98
R6367:Mgat4c UTSW 10 102385154 critical splice donor site probably null
R6459:Mgat4c UTSW 10 102385127 missense probably damaging 1.00
R7021:Mgat4c UTSW 10 102388428 missense possibly damaging 0.82
R7122:Mgat4c UTSW 10 102378209 nonsense probably null
R7146:Mgat4c UTSW 10 102388496 missense probably damaging 1.00
R7877:Mgat4c UTSW 10 102385039 missense probably benign 0.00
R7960:Mgat4c UTSW 10 102385039 missense probably benign 0.00
RF020:Mgat4c UTSW 10 102389067 missense probably benign
X0020:Mgat4c UTSW 10 102388390 missense possibly damaging 0.67
Z1177:Mgat4c UTSW 10 102388450 missense probably damaging 1.00
Z1177:Mgat4c UTSW 10 102388602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACATGGGGTATTATTCATCC -3'
(R):5'- CTCATGCAATGTATGTCAAAGGG -3'

Sequencing Primer
(F):5'- CAGAGAATAAACTGAAGGATGATGAC -3'
(R):5'- TCACATCTGACATTTCAAAGTATCC -3'
Posted On2019-10-24