Incidental Mutation 'R7629:Usp32'
ID 589559
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 6430526O11Rik, 2900074J03Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7629 (G1)
Quality Score 217.468
Status Not validated
Chromosome 11
Chromosomal Location 84984442-85140161 bp(-) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) TTTGGTTG to TTTG at 85019855 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect probably benign
Transcript: ENSMUST00000000821
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108075
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
BB010:Usp32 UTSW 11 85007059 missense probably damaging 1.00
BB020:Usp32 UTSW 11 85007059 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7933:Usp32 UTSW 11 85007059 missense probably damaging 1.00
R7973:Usp32 UTSW 11 85022808 missense probably damaging 0.99
R7989:Usp32 UTSW 11 85034300 missense
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
R8292:Usp32 UTSW 11 85077401 missense probably damaging 0.99
R8305:Usp32 UTSW 11 85032185 missense possibly damaging 0.83
R8548:Usp32 UTSW 11 85017827 missense possibly damaging 0.52
R8924:Usp32 UTSW 11 85025544 missense probably damaging 0.98
R9002:Usp32 UTSW 11 85053951 missense probably damaging 0.96
R9145:Usp32 UTSW 11 85022292 missense probably damaging 1.00
R9209:Usp32 UTSW 11 85040012 missense probably damaging 0.98
R9211:Usp32 UTSW 11 85022733 missense probably damaging 1.00
R9296:Usp32 UTSW 11 85017652 missense probably damaging 1.00
R9310:Usp32 UTSW 11 85051202 missense probably benign 0.29
R9417:Usp32 UTSW 11 84994543 missense probably damaging 1.00
R9514:Usp32 UTSW 11 85022734 missense probably damaging 0.99
R9652:Usp32 UTSW 11 85030491 missense probably damaging 0.97
R9723:Usp32 UTSW 11 85044710 nonsense probably null
R9757:Usp32 UTSW 11 85077329 nonsense probably null
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCAAAGGTTTCTTCTGGGC -3'
(R):5'- ACCTTCAGTTAGCCAAAGAAGATTG -3'

Sequencing Primer
(F):5'- GGTCATTAGACTTGGCTGCAAACC -3'
(R):5'- CCTTTAATCCCAGCAGAAGTAGAGG -3'
Posted On 2019-10-24