Mutagenetix > Incidental Mutation

Incidental Mutation 'R7629:Usp32'

589559

Institutional Source

Beutler Lab

Gene Symbol

Usp32

Ensembl Gene

ENSMUSG00000000804

Gene Name

ubiquitin specific peptidase 32

Synonyms

6430526O11Rik, 2900074J03Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7629 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

84984442-85140161 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

TTTGGTTG to TTTG at 85019855 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000103710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108075]

AlphaFold

F8VPZ3

Predicted Effect

probably benign
Transcript: ENSMUST00000000821

SMART Domains

Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

Domain	Start	End	E-Value	Type
Pfam:UCH	32	260	4.1e-51	PFAM
Pfam:UCH_1	33	228	1.7e-7	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000108075

SMART Domains

Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804

Domain	Start	End	E-Value	Type
EFh	232	260	4.66e0	SMART
EFh	268	296	5.8e-1	SMART
Blast:EFh	318	346	5e-7	BLAST
DUSP	389	588	2.32e-16	SMART
Pfam:Ubiquitin_3	628	711	2.4e-9	PFAM
Pfam:UCH	733	1564	2.4e-83	PFAM
Pfam:UCH_1	1202	1547	2.9e-12	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	G	A	16: 88,707,405	T168I	probably benign	Het
2410089E03Rik	C	T	15: 8,227,067	Q2004*	probably null	Het
Abtb2	T	A	2: 103,683,493		probably null	Het
Ankrd10	A	T	8: 11,615,769	V277E	probably benign	Het
Ankrd28	C	T	14: 31,715,264	V615I	probably benign	Het
Aqr	G	A	2: 114,114,593	P1079L	probably damaging	Het
Brox	G	A	1: 183,292,504	A60V	probably damaging	Het
Copg1	T	C	6: 87,894,169	V289A	possibly damaging	Het
Cyhr1	C	T	15: 76,648,186	D241N	probably benign	Het
D430042O09Rik	T	C	7: 125,795,250	L192P	probably damaging	Het
Dido1	T	C	2: 180,661,473	N1546S	probably benign	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dmxl1	T	A	18: 49,859,270	I361N	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fhod3	T	A	18: 24,754,317	D88E	probably benign	Het
Flywch1	A	G	17: 23,755,770	M632T	probably benign	Het
Henmt1	A	G	3: 108,958,597	T213A	probably benign	Het
Itga9	T	C	9: 118,698,446	V555A	probably benign	Het
Kif13b	C	T	14: 64,779,335	R1317*	probably null	Het
Kndc1	A	T	7: 139,895,260	E25V	probably damaging	Het
Lingo2	T	A	4: 35,708,675	D435V	possibly damaging	Het
Lrrc14b	T	A	13: 74,361,164	M375L	probably benign	Het
Lrrtm2	T	C	18: 35,214,257		probably null	Het
Mgat4c	G	A	10: 102,389,070	V382I	probably benign	Het
Mpp6	T	C	6: 50,196,623	I489T	probably benign	Het
Muc16	T	C	9: 18,566,785	T7075A	possibly damaging	Het
Myo5b	T	A	18: 74,627,254		probably null	Het
Neb	T	C	2: 52,273,961	D1995G	possibly damaging	Het
Nudt9	T	C	5: 104,050,694	V75A	possibly damaging	Het
Olfr1277	C	T	2: 111,269,876	V164I	probably benign	Het
Paf1	T	C	7: 28,395,068	Y35H	probably damaging	Het
Panx3	T	A	9: 37,661,444	Q270L	possibly damaging	Het
Pde6h	G	T	6: 136,959,319	R20L	possibly damaging	Het
Pdxk	A	G	10: 78,445,006	I200T	probably benign	Het
Ppara	A	T	15: 85,798,191	M363L	probably damaging	Het
Prmt8	A	T	6: 127,689,883	L376*	probably null	Het
Serpina1a	G	C	12: 103,853,808	T393R	probably damaging	Het
Sfxn1	C	T	13: 54,093,022	R178C	probably damaging	Het
Sirpb1c	A	T	3: 15,848,395	W7R	possibly damaging	Het
Skint5	T	C	4: 113,942,660	Y104C	probably damaging	Het
Slamf6	A	T	1: 171,936,624	T195S	probably damaging	Het
Slc2a6	T	C	2: 27,024,202	D301G	probably benign	Het
Stab2	A	T	10: 86,883,782		probably null	Het
Tctn3	C	G	19: 40,611,336	D141H	probably damaging	Het
Tnik	A	G	3: 28,661,728	N1164D	probably damaging	Het
Tpcn1	C	T	5: 120,537,937	V711I	probably benign	Het
Trim11	G	A	11: 58,978,334	G32D	probably damaging	Het
Vmn1r72	T	C	7: 11,669,784	I246V	probably benign	Het
Zfp362	G	T	4: 128,786,055	R273S	probably damaging	Het
Zfp715	T	C	7: 43,301,676	D66G	possibly damaging	Het

Other mutations in Usp32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00529:Usp32	APN	11	84994426	missense	probably damaging	1.00
IGL00701:Usp32	APN	11	85059125	splice site	probably null
IGL00848:Usp32	APN	11	85051181	splice site	probably benign
IGL00934:Usp32	APN	11	85007076	missense	probably damaging	1.00
IGL01019:Usp32	APN	11	85039265	missense	probably damaging	0.97
IGL01302:Usp32	APN	11	84988482	missense	probably benign	0.05
IGL01444:Usp32	APN	11	85059164	missense	probably damaging	0.97
IGL01575:Usp32	APN	11	85022802	missense	probably damaging	1.00
IGL01981:Usp32	APN	11	85036524	missense	probably benign	0.02
IGL02118:Usp32	APN	11	85032177	nonsense	probably null
IGL02159:Usp32	APN	11	85005802	splice site	probably null
IGL02227:Usp32	APN	11	84986481	missense	probably damaging	1.00
IGL02363:Usp32	APN	11	85044787	missense	probably benign	0.01
IGL02524:Usp32	APN	11	85010011	nonsense	probably null
IGL02613:Usp32	APN	11	85040070	missense	probably damaging	0.99
IGL02720:Usp32	APN	11	85006991	critical splice donor site	probably null
IGL02738:Usp32	APN	11	85083806	missense	probably damaging	1.00
IGL02929:Usp32	APN	11	84988372	missense	probably benign	0.01
IGL03303:Usp32	APN	11	85022832	missense	probably damaging	1.00
BB010:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
BB020:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
PIT4812001:Usp32	UTSW	11	85010074	missense	probably damaging	1.00
R0026:Usp32	UTSW	11	85032074	missense	possibly damaging	0.48
R0295:Usp32	UTSW	11	85053692	missense	probably damaging	0.98
R1320:Usp32	UTSW	11	85017793	missense	probably damaging	0.98
R1712:Usp32	UTSW	11	85042580	missense	probably benign	0.12
R1922:Usp32	UTSW	11	85007004	nonsense	probably null
R1973:Usp32	UTSW	11	85103931	missense	probably benign	0.09
R2010:Usp32	UTSW	11	85040004	missense	probably damaging	0.98
R2082:Usp32	UTSW	11	85030512	missense	probably damaging	0.99
R2355:Usp32	UTSW	11	85005909	missense	probably benign	0.34
R3147:Usp32	UTSW	11	85029087	missense	probably damaging	1.00
R3160:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3162:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3716:Usp32	UTSW	11	85042563	missense	probably damaging	1.00
R3816:Usp32	UTSW	11	84994384	critical splice donor site	probably null
R3870:Usp32	UTSW	11	85007055	nonsense	probably null
R3871:Usp32	UTSW	11	85081156	missense	probably null	0.81
R4041:Usp32	UTSW	11	85017739	missense	probably benign	0.40
R4079:Usp32	UTSW	11	85039229	missense	probably damaging	0.98
R4332:Usp32	UTSW	11	85103978	missense	possibly damaging	0.79
R4396:Usp32	UTSW	11	85053975	missense	probably benign
R4580:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4620:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4744:Usp32	UTSW	11	84994393	missense	probably damaging	1.00
R4909:Usp32	UTSW	11	85055772	nonsense	probably null
R5056:Usp32	UTSW	11	85026795	missense	probably benign	0.07
R5111:Usp32	UTSW	11	85077331	missense	possibly damaging	0.95
R5213:Usp32	UTSW	11	85022259	missense	probably damaging	1.00
R5308:Usp32	UTSW	11	85017718	missense	probably benign	0.12
R5381:Usp32	UTSW	11	85059127	critical splice donor site	probably benign
R5538:Usp32	UTSW	11	85017786	missense	possibly damaging	0.65
R5659:Usp32	UTSW	11	85077414	missense	possibly damaging	0.94
R6006:Usp32	UTSW	11	84992451	critical splice donor site	probably null
R6011:Usp32	UTSW	11	85032097	missense	possibly damaging	0.70
R6029:Usp32	UTSW	11	85025582	missense	probably damaging	0.99
R6074:Usp32	UTSW	11	84994573	missense	probably benign	0.00
R6331:Usp32	UTSW	11	84986576	missense	possibly damaging	0.92
R6353:Usp32	UTSW	11	85022281	missense	probably benign
R6714:Usp32	UTSW	11	85026870	missense	probably damaging	0.99
R6778:Usp32	UTSW	11	85025686	missense	probably benign	0.00
R6988:Usp32	UTSW	11	85010143	missense	probably benign	0.35
R6992:Usp32	UTSW	11	85032088	missense	probably damaging	0.99
R7182:Usp32	UTSW	11	85040170	missense	probably benign	0.34
R7186:Usp32	UTSW	11	85051234	missense	probably benign	0.45
R7198:Usp32	UTSW	11	85022855	frame shift	probably null
R7201:Usp32	UTSW	11	85022855	frame shift	probably null
R7469:Usp32	UTSW	11	84988553	missense	possibly damaging	0.94
R7502:Usp32	UTSW	11	85022898	missense	possibly damaging	0.48
R7513:Usp32	UTSW	11	85027112	nonsense	probably null
R7703:Usp32	UTSW	11	85077327	missense	probably damaging	0.99
R7741:Usp32	UTSW	11	84987281	missense	probably damaging	0.99
R7765:Usp32	UTSW	11	84994408	missense	probably damaging	1.00
R7933:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
R7973:Usp32	UTSW	11	85022808	missense	probably damaging	0.99
R7989:Usp32	UTSW	11	85034300	missense
R7998:Usp32	UTSW	11	84994426	missense	probably damaging	1.00
R8292:Usp32	UTSW	11	85077401	missense	probably damaging	0.99
R8305:Usp32	UTSW	11	85032185	missense	possibly damaging	0.83
R8548:Usp32	UTSW	11	85017827	missense	possibly damaging	0.52
R8924:Usp32	UTSW	11	85025544	missense	probably damaging	0.98
R9002:Usp32	UTSW	11	85053951	missense	probably damaging	0.96
R9145:Usp32	UTSW	11	85022292	missense	probably damaging	1.00
R9209:Usp32	UTSW	11	85040012	missense	probably damaging	0.98
R9211:Usp32	UTSW	11	85022733	missense	probably damaging	1.00
R9296:Usp32	UTSW	11	85017652	missense	probably damaging	1.00
R9310:Usp32	UTSW	11	85051202	missense	probably benign	0.29
R9417:Usp32	UTSW	11	84994543	missense	probably damaging	1.00
R9514:Usp32	UTSW	11	85022734	missense	probably damaging	0.99
R9652:Usp32	UTSW	11	85030491	missense	probably damaging	0.97
R9723:Usp32	UTSW	11	85044710	nonsense	probably null
R9757:Usp32	UTSW	11	85077329	nonsense	probably null
X0028:Usp32	UTSW	11	84992606	missense	probably benign	0.05
Z1177:Usp32	UTSW	11	84988612	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGTCAAAGGTTTCTTCTGGGC -3'
(R):5'- ACCTTCAGTTAGCCAAAGAAGATTG -3'

Sequencing Primer
(F):5'- GGTCATTAGACTTGGCTGCAAACC -3'
(R):5'- CCTTTAATCCCAGCAGAAGTAGAGG -3'

Posted On

2019-10-24