Incidental Mutation 'R7629:Serpina1a'
ID 589560
Institutional Source Beutler Lab
Gene Symbol Serpina1a
Ensembl Gene ENSMUSG00000066366
Gene Name serine (or cysteine) peptidase inhibitor, clade A, member 1A
Synonyms PI1, Aat2, Spi1-1, Aat-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 103853589-103863562 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 103853808 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Arginine at position 393 (T393R)
Ref Sequence ENSEMBL: ENSMUSP00000072652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072876] [ENSMUST00000085056] [ENSMUST00000124717]
AlphaFold P07758
Predicted Effect probably damaging
Transcript: ENSMUST00000072876
AA Change: T393R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072652
Gene: ENSMUSG00000066366
AA Change: T393R

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
SERPIN 53 410 1.09e-203 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085056
AA Change: T370R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082132
Gene: ENSMUSG00000066366
AA Change: T370R

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
SERPIN 53 410 1.09e-203 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124717
SMART Domains Protein: ENSMUSP00000120398
Gene: ENSMUSG00000066366

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
Pfam:Serpin 46 96 2.7e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die prior to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Serpina1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:Serpina1a APN 12 103854706 missense probably damaging 0.99
IGL02511:Serpina1a APN 12 103855967 nonsense probably null
R0071:Serpina1a UTSW 12 103855743 missense probably benign 0.03
R1610:Serpina1a UTSW 12 103853837 missense possibly damaging 0.69
R1959:Serpina1a UTSW 12 103853800 nonsense probably null
R3107:Serpina1a UTSW 12 103853841 missense probably damaging 1.00
R3108:Serpina1a UTSW 12 103853841 missense probably damaging 1.00
R4303:Serpina1a UTSW 12 103854675 missense probably damaging 1.00
R4814:Serpina1a UTSW 12 103854763 missense probably benign 0.01
R6011:Serpina1a UTSW 12 103857469 missense probably damaging 0.97
R6547:Serpina1a UTSW 12 103855921 missense probably damaging 1.00
R6548:Serpina1a UTSW 12 103853758 missense probably benign 0.00
R6724:Serpina1a UTSW 12 103860420 intron probably benign
R6915:Serpina1a UTSW 12 103853851 missense possibly damaging 0.68
R6991:Serpina1a UTSW 12 103853833 missense probably benign 0.04
R7570:Serpina1a UTSW 12 103853837 missense possibly damaging 0.69
R8353:Serpina1a UTSW 12 103855779 missense probably benign 0.01
R8556:Serpina1a UTSW 12 103855970 missense probably damaging 1.00
R8909:Serpina1a UTSW 12 103854679 missense probably damaging 0.97
R9021:Serpina1a UTSW 12 103858034 missense probably benign 0.01
R9058:Serpina1a UTSW 12 103853742 missense possibly damaging 0.94
Z1088:Serpina1a UTSW 12 103854667 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTGTGTTTAATGGAAGGAACCC -3'
(R):5'- TAAGTGGTCACCGTGAAAGG -3'

Sequencing Primer
(F):5'- GTTTAATGGAAGGAACCCAATTCAG -3'
(R):5'- TCACCGTGAAAGGGGTCTG -3'
Posted On 2019-10-24