Mutagenetix > Incidental Mutations

Incidental Mutation 'R7629:Sfxn1'

589561

Institutional Source

Beutler Lab

Gene Symbol

Sfxn1

Ensembl Gene

ENSMUSG00000021474

Gene Name

sideroflexin 1

Synonyms

2810002O05Rik, A930015P12Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7629 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

54071869-54108342 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 54093022 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 178 (R178C)

Ref Sequence

ENSEMBL: ENSMUSP00000021930 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021930]

AlphaFold

Q99JR1

Predicted Effect

probably damaging
Transcript: ENSMUST00000021930
AA Change: R178C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021930
Gene: ENSMUSG00000021474
AA Change: R178C

Domain	Start	End	E-Value	Type
Pfam:Mtc	16	322	8.3e-154	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	G	A	16: 88,707,405	T168I	probably benign	Het
2410089E03Rik	C	T	15: 8,227,067	Q2004*	probably null	Het
Abtb2	T	A	2: 103,683,493		probably null	Het
Ankrd10	A	T	8: 11,615,769	V277E	probably benign	Het
Ankrd28	C	T	14: 31,715,264	V615I	probably benign	Het
Aqr	G	A	2: 114,114,593	P1079L	probably damaging	Het
Brox	G	A	1: 183,292,504	A60V	probably damaging	Het
Copg1	T	C	6: 87,894,169	V289A	possibly damaging	Het
Cyhr1	C	T	15: 76,648,186	D241N	probably benign	Het
D430042O09Rik	T	C	7: 125,795,250	L192P	probably damaging	Het
Dido1	T	C	2: 180,661,473	N1546S	probably benign	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dmxl1	T	A	18: 49,859,270	I361N	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fhod3	T	A	18: 24,754,317	D88E	probably benign	Het
Flywch1	A	G	17: 23,755,770	M632T	probably benign	Het
Henmt1	A	G	3: 108,958,597	T213A	probably benign	Het
Itga9	T	C	9: 118,698,446	V555A	probably benign	Het
Kif13b	C	T	14: 64,779,335	R1317*	probably null	Het
Kndc1	A	T	7: 139,895,260	E25V	probably damaging	Het
Lingo2	T	A	4: 35,708,675	D435V	possibly damaging	Het
Lrrc14b	T	A	13: 74,361,164	M375L	probably benign	Het
Lrrtm2	T	C	18: 35,214,257		probably null	Het
Mgat4c	G	A	10: 102,389,070	V382I	probably benign	Het
Mpp6	T	C	6: 50,196,623	I489T	probably benign	Het
Muc16	T	C	9: 18,566,785	T7075A	possibly damaging	Het
Myo5b	T	A	18: 74,627,254		probably null	Het
Neb	T	C	2: 52,273,961	D1995G	possibly damaging	Het
Nudt9	T	C	5: 104,050,694	V75A	possibly damaging	Het
Olfr1277	C	T	2: 111,269,876	V164I	probably benign	Het
Paf1	T	C	7: 28,395,068	Y35H	probably damaging	Het
Panx3	T	A	9: 37,661,444	Q270L	possibly damaging	Het
Pde6h	G	T	6: 136,959,319	R20L	possibly damaging	Het
Pdxk	A	G	10: 78,445,006	I200T	probably benign	Het
Ppara	A	T	15: 85,798,191	M363L	probably damaging	Het
Prmt8	A	T	6: 127,689,883	L376*	probably null	Het
Serpina1a	G	C	12: 103,853,808	T393R	probably damaging	Het
Sirpb1c	A	T	3: 15,848,395	W7R	possibly damaging	Het
Skint5	T	C	4: 113,942,660	Y104C	probably damaging	Het
Slamf6	A	T	1: 171,936,624	T195S	probably damaging	Het
Slc2a6	T	C	2: 27,024,202	D301G	probably benign	Het
Stab2	A	T	10: 86,883,782		probably null	Het
Tctn3	C	G	19: 40,611,336	D141H	probably damaging	Het
Tnik	A	G	3: 28,661,728	N1164D	probably damaging	Het
Tpcn1	C	T	5: 120,537,937	V711I	probably benign	Het
Trim11	G	A	11: 58,978,334	G32D	probably damaging	Het
Usp32	TTTGGTTG	TTTG	11: 85,019,855		probably null	Het
Vmn1r72	T	C	7: 11,669,784	I246V	probably benign	Het
Zfp362	G	T	4: 128,786,055	R273S	probably damaging	Het
Zfp715	T	C	7: 43,301,676	D66G	possibly damaging	Het

Other mutations in Sfxn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01433:Sfxn1	APN	13	54093916	missense	probably benign
IGL01775:Sfxn1	APN	13	54105739	splice site	probably benign
IGL02536:Sfxn1	APN	13	54085494	missense	probably benign
R1467:Sfxn1	UTSW	13	54093871	missense	possibly damaging	0.75
R1467:Sfxn1	UTSW	13	54093871	missense	possibly damaging	0.75
R1468:Sfxn1	UTSW	13	54085627	splice site	probably null
R1468:Sfxn1	UTSW	13	54085627	splice site	probably null
R1476:Sfxn1	UTSW	13	54092450	critical splice donor site	probably null
R1931:Sfxn1	UTSW	13	54093933	missense	probably damaging	0.96
R2224:Sfxn1	UTSW	13	54085517	missense	possibly damaging	0.96
R2225:Sfxn1	UTSW	13	54085517	missense	possibly damaging	0.96
R2226:Sfxn1	UTSW	13	54085517	missense	possibly damaging	0.96
R2288:Sfxn1	UTSW	13	54093957	missense	probably benign	0.37
R4655:Sfxn1	UTSW	13	54092438	missense	probably benign	0.14
R4989:Sfxn1	UTSW	13	54088914	missense	probably benign	0.14
R5064:Sfxn1	UTSW	13	54085569	missense	probably benign	0.05
R5950:Sfxn1	UTSW	13	54091287	missense	probably benign	0.05
R6046:Sfxn1	UTSW	13	54088942	missense	probably benign	0.14
R6170:Sfxn1	UTSW	13	54106507	missense	probably benign	0.16
R6267:Sfxn1	UTSW	13	54093880	missense	probably benign	0.03
R6296:Sfxn1	UTSW	13	54093880	missense	probably benign	0.03
R6322:Sfxn1	UTSW	13	54104850	missense	possibly damaging	0.66
R6500:Sfxn1	UTSW	13	54088899	missense	probably benign
R6634:Sfxn1	UTSW	13	54093029	missense	probably damaging	1.00
R6719:Sfxn1	UTSW	13	54106564	missense	probably benign
R7814:Sfxn1	UTSW	13	54091231	missense	possibly damaging	0.93
R8905:Sfxn1	UTSW	13	54092414	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GATTGTCACTGTATGTCCTTGC -3'
(R):5'- CTAGAGACACACCTCTGCTTCG -3'

Sequencing Primer
(F):5'- CTGTATGTCCTTGCCAGAGATACAG -3'
(R):5'- GCTTCGGCCCACTTCAGTAAG -3'

Posted On

2019-10-24