Mutagenetix > Incidental Mutations

Incidental Mutation 'R7629:Kif13b'

589565

Institutional Source

Beutler Lab

Gene Symbol

Kif13b

Ensembl Gene

ENSMUSG00000060012

Gene Name

kinesin family member 13B

Synonyms

N-3 kinesin, C130021D12Rik, 5330429L19Rik, GAKIN

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7629 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64647265-64809617 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 64779335 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 1317 (R1317*)

Ref Sequence

ENSEMBL: ENSMUSP00000098041 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100473] [ENSMUST00000224503]

AlphaFold

A0A286YCV9

Predicted Effect

probably null
Transcript: ENSMUST00000100473
AA Change: R1317*

SMART Domains

Protein: ENSMUSP00000098041
Gene: ENSMUSG00000060012
AA Change: R1317*

Domain	Start	End	E-Value	Type
KISc	3	361	1.4e-182	SMART
FHA	470	520	6.86e-1	SMART
low complexity region	546	560	N/A	INTRINSIC
coiled coil region	617	646	N/A	INTRINSIC
coiled coil region	669	701	N/A	INTRINSIC
Pfam:KIF1B	756	802	4.1e-20	PFAM
Pfam:DUF3694	1003	1279	1.4e-37	PFAM
low complexity region	1514	1526	N/A	INTRINSIC
low complexity region	1532	1548	N/A	INTRINSIC
low complexity region	1574	1589	N/A	INTRINSIC
low complexity region	1617	1630	N/A	INTRINSIC
CAP_GLY	1719	1784	1.54e-29	SMART
low complexity region	1814	1826	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000224503
AA Change: R1317*

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating cholesterol and factor VIII levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	G	A	16: 88,707,405	T168I	probably benign	Het
2410089E03Rik	C	T	15: 8,227,067	Q2004*	probably null	Het
Abtb2	T	A	2: 103,683,493		probably null	Het
Ankrd10	A	T	8: 11,615,769	V277E	probably benign	Het
Ankrd28	C	T	14: 31,715,264	V615I	probably benign	Het
Aqr	G	A	2: 114,114,593	P1079L	probably damaging	Het
Brox	G	A	1: 183,292,504	A60V	probably damaging	Het
Copg1	T	C	6: 87,894,169	V289A	possibly damaging	Het
Cyhr1	C	T	15: 76,648,186	D241N	probably benign	Het
D430042O09Rik	T	C	7: 125,795,250	L192P	probably damaging	Het
Dido1	T	C	2: 180,661,473	N1546S	probably benign	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dmxl1	T	A	18: 49,859,270	I361N	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fhod3	T	A	18: 24,754,317	D88E	probably benign	Het
Flywch1	A	G	17: 23,755,770	M632T	probably benign	Het
Henmt1	A	G	3: 108,958,597	T213A	probably benign	Het
Itga9	T	C	9: 118,698,446	V555A	probably benign	Het
Kndc1	A	T	7: 139,895,260	E25V	probably damaging	Het
Lingo2	T	A	4: 35,708,675	D435V	possibly damaging	Het
Lrrc14b	T	A	13: 74,361,164	M375L	probably benign	Het
Lrrtm2	T	C	18: 35,214,257		probably null	Het
Mgat4c	G	A	10: 102,389,070	V382I	probably benign	Het
Mpp6	T	C	6: 50,196,623	I489T	probably benign	Het
Muc16	T	C	9: 18,566,785	T7075A	possibly damaging	Het
Myo5b	T	A	18: 74,627,254		probably null	Het
Neb	T	C	2: 52,273,961	D1995G	possibly damaging	Het
Nudt9	T	C	5: 104,050,694	V75A	possibly damaging	Het
Olfr1277	C	T	2: 111,269,876	V164I	probably benign	Het
Paf1	T	C	7: 28,395,068	Y35H	probably damaging	Het
Panx3	T	A	9: 37,661,444	Q270L	possibly damaging	Het
Pde6h	G	T	6: 136,959,319	R20L	possibly damaging	Het
Pdxk	A	G	10: 78,445,006	I200T	probably benign	Het
Ppara	A	T	15: 85,798,191	M363L	probably damaging	Het
Prmt8	A	T	6: 127,689,883	L376*	probably null	Het
Serpina1a	G	C	12: 103,853,808	T393R	probably damaging	Het
Sfxn1	C	T	13: 54,093,022	R178C	probably damaging	Het
Sirpb1c	A	T	3: 15,848,395	W7R	possibly damaging	Het
Skint5	T	C	4: 113,942,660	Y104C	probably damaging	Het
Slamf6	A	T	1: 171,936,624	T195S	probably damaging	Het
Slc2a6	T	C	2: 27,024,202	D301G	probably benign	Het
Stab2	A	T	10: 86,883,782		probably null	Het
Tctn3	C	G	19: 40,611,336	D141H	probably damaging	Het
Tnik	A	G	3: 28,661,728	N1164D	probably damaging	Het
Tpcn1	C	T	5: 120,537,937	V711I	probably benign	Het
Trim11	G	A	11: 58,978,334	G32D	probably damaging	Het
Usp32	TTTGGTTG	TTTG	11: 85,019,855		probably null	Het
Vmn1r72	T	C	7: 11,669,784	I246V	probably benign	Het
Zfp362	G	T	4: 128,786,055	R273S	probably damaging	Het
Zfp715	T	C	7: 43,301,676	D66G	possibly damaging	Het

Other mutations in Kif13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Kif13b	APN	14	64669693	missense	possibly damaging	0.81
IGL00485:Kif13b	APN	14	64765073	missense	possibly damaging	0.88
IGL00495:Kif13b	APN	14	64714113	missense	probably benign	0.07
IGL00556:Kif13b	APN	14	64744888	missense	probably damaging	1.00
IGL00571:Kif13b	APN	14	64746417	missense	probably damaging	0.99
IGL00590:Kif13b	APN	14	64779462	missense	probably damaging	1.00
IGL01650:Kif13b	APN	14	64765145	missense	probably benign	0.00
IGL01730:Kif13b	APN	14	64750361	critical splice donor site	probably null
IGL01908:Kif13b	APN	14	64757558	missense	probably damaging	1.00
IGL02388:Kif13b	APN	14	64800358	missense	probably damaging	1.00
IGL02573:Kif13b	APN	14	64803431	missense	probably damaging	1.00
IGL02661:Kif13b	APN	14	64767691	missense	probably benign	0.06
IGL02794:Kif13b	APN	14	64803440	missense	probably benign	0.00
IGL02959:Kif13b	APN	14	64767717	missense	probably damaging	1.00
IGL02979:Kif13b	APN	14	64789697	missense	probably damaging	0.96
IGL03114:Kif13b	APN	14	64788448	missense	probably benign	0.00
R0024:Kif13b	UTSW	14	64750273	missense	probably benign	0.30
R0330:Kif13b	UTSW	14	64803220	missense	probably benign
R0376:Kif13b	UTSW	14	64757404	splice site	probably benign
R0571:Kif13b	UTSW	14	64751528	missense	probably damaging	1.00
R0718:Kif13b	UTSW	14	64751662	splice site	probably benign
R1144:Kif13b	UTSW	14	64714117	missense	probably benign	0.01
R1183:Kif13b	UTSW	14	64782377	missense	probably benign	0.00
R1264:Kif13b	UTSW	14	64776232	splice site	probably benign
R1497:Kif13b	UTSW	14	64736266	missense	probably damaging	0.99
R1579:Kif13b	UTSW	14	64782341	critical splice acceptor site	probably null
R1624:Kif13b	UTSW	14	64738619	missense	probably damaging	0.99
R1706:Kif13b	UTSW	14	64760666	splice site	probably benign
R2176:Kif13b	UTSW	14	64669671	missense	probably benign	0.01
R3727:Kif13b	UTSW	14	64765748	splice site	probably benign
R3785:Kif13b	UTSW	14	64800400	missense	probably benign	0.00
R3786:Kif13b	UTSW	14	64800400	missense	probably benign	0.00
R4088:Kif13b	UTSW	14	64767455	critical splice donor site	probably null
R4279:Kif13b	UTSW	14	64779356	missense	probably damaging	1.00
R4559:Kif13b	UTSW	14	64806132	missense	probably damaging	0.98
R4689:Kif13b	UTSW	14	64773064	missense	probably damaging	1.00
R4692:Kif13b	UTSW	14	64803575	missense	probably benign	0.05
R4878:Kif13b	UTSW	14	64806154	missense	probably benign	0.00
R4971:Kif13b	UTSW	14	64757562	missense	possibly damaging	0.90
R5037:Kif13b	UTSW	14	64758589	nonsense	probably null
R5119:Kif13b	UTSW	14	64757453	missense	probably benign	0.01
R5167:Kif13b	UTSW	14	64772935	missense	probably damaging	1.00
R5408:Kif13b	UTSW	14	64779689	critical splice acceptor site	probably null
R5437:Kif13b	UTSW	14	64806114	missense	probably damaging	0.99
R5756:Kif13b	UTSW	14	64736305	missense	probably damaging	1.00
R5838:Kif13b	UTSW	14	64737555	missense	probably damaging	1.00
R5891:Kif13b	UTSW	14	64788405	splice site	probably null
R6120:Kif13b	UTSW	14	64751558	missense	probably damaging	1.00
R6150:Kif13b	UTSW	14	64751639	missense	probably damaging	0.99
R6165:Kif13b	UTSW	14	64742311	missense	probably damaging	1.00
R6187:Kif13b	UTSW	14	64736215	missense	probably damaging	1.00
R6229:Kif13b	UTSW	14	64738567	missense	probably damaging	1.00
R6267:Kif13b	UTSW	14	64738634	missense	probably damaging	1.00
R6347:Kif13b	UTSW	14	64767619	missense	probably benign	0.26
R6479:Kif13b	UTSW	14	64751525	missense	probably benign	0.08
R6512:Kif13b	UTSW	14	64744874	critical splice acceptor site	probably null
R6851:Kif13b	UTSW	14	64773065	missense	probably damaging	1.00
R7131:Kif13b	UTSW	14	64773068	missense	probably damaging	1.00
R7217:Kif13b	UTSW	14	64773068	missense	probably damaging	1.00
R7398:Kif13b	UTSW	14	64757523	missense	probably null	0.02
R7427:Kif13b	UTSW	14	64788460	missense	probably benign
R7428:Kif13b	UTSW	14	64788460	missense	probably benign
R7573:Kif13b	UTSW	14	64803658	missense	probably benign	0.00
R7683:Kif13b	UTSW	14	64757507	missense	probably benign	0.24
R7835:Kif13b	UTSW	14	64767452	missense	probably benign	0.00
R7895:Kif13b	UTSW	14	64736149	missense	probably damaging	1.00
R8285:Kif13b	UTSW	14	64782376	missense	probably benign	0.03
R8374:Kif13b	UTSW	14	64788435	missense	probably damaging	0.97
R8467:Kif13b	UTSW	14	64758705	missense	probably damaging	0.96
R8804:Kif13b	UTSW	14	64750342	missense	probably damaging	0.99
R8859:Kif13b	UTSW	14	64742433	missense	probably benign	0.04
R8891:Kif13b	UTSW	14	64744877	missense	probably damaging	1.00
R9236:Kif13b	UTSW	14	64744934	missense	probably benign	0.22
Z1176:Kif13b	UTSW	14	64803344	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCATGTATCAGTGTGCTTGAGC -3'
(R):5'- TATAGAGGCCAGATGGGAGTCC -3'

Sequencing Primer
(F):5'- AGCATGTGTGTTTACATCTGTAATG -3'
(R):5'- TCCACCACAGCGCTGTTG -3'

Posted On

2019-10-24